D3Wox33 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D3Wox33

Symbol: D3Wox33
Previously known as: oxsts4915; REP350; 
RGD ID: 1358021
Expected Size: 118 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0379,235,931 - 79,236,059NCBIRnor6.0
Celera375,624,332 - 75,624,449UniSTS
Cytogenetic Map3q32-q33UniSTS
Is Marker For: QTLs:   Bw38  
Genes:   Ptprj  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Chromosomal Mapping of Quantitative Trait Loci Controlling Elastin Content in Rat Aorta. Gauguier D, etal., Hypertension 2005 Jan 24;.
3. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CGATGCTCTGGGTTCTTAGT
Reverse Primer AGATCACCACGCTATAAAACAC
 

Region

Nucleotide Sequences
RefSeq Transcripts NM_017269 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide U40790 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 29645 UniSTS
NCBI Nucleotide D3Wox33
UniSTS 240530 UniSTS