D20Arb2 Marker Search Result - Rat Genome Database

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

General

Marker: D20Arb2

Symbol:

D20Arb2

Previously known as:

oxsts7797; R0270-D07;

RGD ID:

11206

Expected Size:

164 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	20	2,666,495 - 2,666,654 (+)	MAPPER	mRatBN7.2
mRatBN7.2	20	2,646,395 - 2,646,556 (+)	MAPPER	mRatBN7.2
Rnor_6.0	20	3,151,815 - 3,151,975	NCBI	Rnor6.0
Rnor_6.0	20	3,171,911 - 3,172,069	NCBI	Rnor6.0
Rnor_5.0	20	5,270,077 - 5,270,235	UniSTS	Rnor5.0
Rnor_5.0	20	5,249,981 - 5,250,141	UniSTS	Rnor5.0
RGSC_v3.4	20	2,790,512 - 2,790,672	UniSTS	RGSC3.4
RGSC_v3.4	20	2,811,408 - 2,811,567	RGD	RGSC3.4
RGSC_v3.4	20	2,790,511 - 2,790,672	RGD	RGSC3.4
RGSC_v3.4	20	2,811,409 - 2,811,567	UniSTS	RGSC3.4
RGSC_v3.1	20	2,790,738 - 2,790,899	RGD
Celera	20	76,870 - 77,030	UniSTS
Celera	20	96,911 - 97,069	UniSTS
SHRSP x BN Map	20	0.0	RGD
SHRSP x BN Map	20	0.0	UniSTS
FHH x ACI Map	20	0.16	RGD

Is Marker For:

Strains: AVN/Orl BBDP/Rhw BBDR/Rhw BC/CpbU BDIX/Han BDVII/Cub BN/SsNHsd BP/Cub BUF/Pit DA/PitN DON/Melb F344/Pit FHH/Eur IS/Kyo LE/Mol LEW/Pit LH/Mav MHS/Gib MNRA/N WN/N WKY/OlaHsd WTC/Kyo LOU/CHan MNR/N MR/Pit ODU/N WF/Pit WIST/Nhg SR/Jr MNS/Gib NP9 OKA/Wsl OM/Ztm P5C PVG/Pit SD/Rij SHR/OlaHsd SHRSP/Riv WAG/RijKyo GK/KyoSwe M520/N ACI/N BN-Lx/Cub LN/Mav DA.F344-Aia1/1 F344.DA-(D20Arb2-D20Arb8)/Arb DA.F344-(D20Arb2-D20Arb8)/Arb GH/Omr NEDH/K SS/Jr COP/OlaHsd
QTLs: Ciaa1 Aia1
Genes: Ciaa1

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	Genetic dissection of a rat model for rheumatoid arthritis: significant gender influences on autosomal modifier loci	Furuya T, etal., Hum Mol Genet 2000 Sep 22;9(15):2241-50
3.	Identification of four new quantitative trait loci regulating arthritis severity and one new quantitative trait locus regulating autoantibody production in rats with collagen-induced arthritis.	Griffiths MM, etal., Arthritis Rheum 2000 Jun;43(6):1278-89
4.	A genetic linkage map of rat chromosome 20 derived from five F2 crosses.	Kawahito Y, etal., Immunogenetics 1998 Oct;48(5):335-8
5.	Localization of quantitative trait loci regulating adjuvant-induced arthritis in rats: evidence for genetic factors common to multiple autoimmune diseases.	Kawahito Y, etal., J Immunol 1998 Oct 15;161(8):4411-9
6.	Rat Genetic Map Data	Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
7.	Electronic Transfer of SSLP Data	Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
8.	A genome scan localizes five non-MHC loci controlling collagen-induced arthritis in rats.	Remmers EF, etal., Nat Genet 1996 Sep;14(1):82-5
9.	UniSTS Pipeline	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	CAGGAGGATTAAGAGAGGTGCC
Reverse Primer	CTGGCTTCAGAGATTCAACTGC

Strain Variation

Strain, Expected Size(s)

ACI/N	164
AVN/Orl	162
BBDP/Rhw	176
BBDR/Rhw	160
BC/CpbU	162
BDIX/Han	172
BDVII/Cub	162
BN-Lx/Cub	160
BN/SsNHsd	160
BP/Cub	172
BUF/Pit	164
COP/OlaHsd	164
DA/PitN	166

DON/Melb	164
F344/Pit	162
FHH/Eur	162
GH/Omr	172
GK/KyoSwe	180
IS/Kyo	176
LE/Mol	162
LEW/Pit	176
LH/Mav	162
LN/Mav	162
LOU/CHan	176
M520/N	162
MHS/Gib	176

MNR/N	160
MNRA/N	160
MNS/Gib	176
MR/Pit	160
NEDH/K	164
NP9	160
ODU/N	176
OKA/Wsl	180
OM/Ztm	162
P5C	176
PVG/Pit	162
SD/Rij	176
SHR/OlaHsd	180

SHRSP/Riv	180
SR/Jr	160
SS/Jr	160
WAG/RijKyo	176
WF/Pit	180
WIST/Nhg	176
WKY/OlaHsd	176
WN/N	172
WTC/Kyo	176

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
41288091	LOC120093125	H-2 class I histocompatibility antigen, Q7 alpha chain-like	20	2624073	2658023	Rat
1595920	RT1-S2	RT1 class Ib, locus S2	20	2650233	2651654	Rat
1595735	Rps2-ps1	ribosomal protein S2, pseudogene 1	20	2654057	2654785	Rat
3501	RT1-O1	RT1 class Ib, locus O1	20	2655116	2657520	Rat
1598370	RT1-N3	RT1 class Ib, locus N3	20	2659132	2665536	Rat

Nucleotide Sequences


GenBank Nucleotide	BX883048	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CH474118.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	L23127	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	M74822	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
724519	Bp144	Blood pressure QTL 144		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	20	1	3624629	Rat
1354642	Despr15	Despair related QTL 15		0.0027	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	20	1	24159021	Rat
1600382	Edcs3	Endometrial carcinoma susceptibility QTL3	3.5	0.003	uterus morphology trait (VT:0001120)	percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)	20	1	25159026	Rat
2317851	Alcrsp22	Alcohol response QTL 22	3.2	0.05	response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	20	1	27339237	Rat
1641893	Alcrsp7	Alcohol response QTL 7			response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	20	1	27339237	Rat
8694189	Bw153	Body weight QTL 153	3.13	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	20	1	29191651	Rat
9590275	Scort15	Serum corticosterone level QTL 15	3.48	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	20	1	29191651	Rat
7411650	Foco23	Food consumption QTL 23	20.7	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	20	1	29191651	Rat
9590109	Sffal8	Serum free fatty acids level QTL 8	5.32	0.01	blood free fatty acid amount (VT:0001553)	plasma free fatty acids level (CMO:0000546)	20	1	29191651	Rat
9589155	Insul32	Insulin level QTL 32	6.38	0.001	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	20	1	29191651	Rat
6893685	Bw111	Body weight QTL 111	2.7	0.004	body mass (VT:0001259)	body weight (CMO:0000012)	20	1	32578807	Rat
7411668	Foco32	Food consumption QTL 32	8	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	20	1	36600972	Rat
9590252	Scort12	Serum corticosterone level QTL 12	20.46	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	20	1	36600972	Rat
2305926	Iddm37	Insulin dependent diabetes mellitus QTL 37	6		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	20	1527842	46527842	Rat
2306850	Pia40	Pristane induced arthritis QTL 40		0.0001	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	20	1527959	5304575	Rat
1641915	Colcr9	Colorectal carcinoma resistance QTL 9	2.97	0.0024	intestine integrity trait (VT:0010554)	benign colorectal tumor number (CMO:0001795)	20	1530655	46530655	Rat
1598816	Memor12	Memory QTL 12	2.4		exploratory behavior trait (VT:0010471)	average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)	20	2606836	47606836	Rat
61448	Ciaa1	CIA Autoantibody QTL 1	30	0.001	blood autoantibody amount (VT:0003725)	calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)	20	2646395	4597031	Rat
61472	Aia1	Adjuvant induced arthritis QTL 1	18	0.001	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	20	2646395	4597031	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	326474	UniSTS
	474368	UniSTS
UniSTS	227284	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D20Arb2