D1Wox33 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Wox33

Symbol: D1Wox33
Previously known as: oxsts4667; REP30; 
RGD ID: 11019
Expected Size: 159 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_5.02224,991,853 - 224,991,955NCBIRnor5.0
Rnor_5.01174,300,636 - 174,300,801NCBIRnor5.0
RGSC_v3.41160,754,901 - 160,755,065RGDRGSC3.4
RGSC_v3.42198,300,754 - 198,300,855RGDRGSC3.4
RGSC_v3.12198,263,508 - 198,263,609RGD
RH 3.4 Map11289.0UniSTS
RH 3.4 Map11289.0RGD
Cytogenetic Map1q32UniSTS
Is Marker For: Strains:   SHR.WKY-(D1Wox33-D1Got194)   SHRSP.WKY-(D1Smu13-D1Wox33)/Izm   WKY.SHRSP-(D1Rat171-D1Wox33)/Izm  
QTLs:   Stresp24  
Genes:   Nras-ps1  


Annotation


References - curated
# Reference Title Reference Citation
1. A linkage map of the rat genome derived from three F2 crosses. Bihoreau MT, etal., Genome Res 1997 May;7(5):434-40.
2. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
3. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
4. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTAGCAGGCAGTTATATCTTTG
Reverse Primer GGGATGGTGAGATGGGAA
 

Region



Additional Information

Database Acc Id Source(s)
NCBI Gene 100528000 UniSTS
  100528001 UniSTS
  25025 UniSTS
UniSTS 119239 UniSTS