D6Mgh2 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D6Mgh2

Symbol: D6Mgh2
Previously known as: EFIAA; Efla; oxsts5160; 
RGD ID: 10507
Expected Size: 147 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.26127,656,788 - 127,656,935 (+)MAPPERmRatBN7.2
Rnor_6.06132,652,096 - 132,652,240NCBIRnor6.0
Rnor_5.06141,822,172 - 141,822,316UniSTSRnor5.0
RGSC_v3.46133,081,235 - 133,081,380RGDRGSC3.4
RGSC_v3.46133,081,236 - 133,081,380UniSTSRGSC3.4
RGSC_v3.16133,087,422 - 133,087,567RGD
Celera6125,209,113 - 125,209,259UniSTS
Cytogenetic Map6q32UniSTS
Is Marker For: Strains:   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   WAG/RijKyo   M520/N   ACI/N   BN-Lx/Cub   GH/Omr   NEDH/K   SS/Jr  
QTLs:   Iddm8  
Genes:   Ef1   Ybx1-ps24  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Mapping of novel genes predisposing or protecting diabetes development in the BB/OK rat. Kloting I, etal., Biochem Biophys Res Commun 1998 Apr 17;245(2):483-6
3. UniSTS Pipeline RGD automated pipelines
4. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer GTTCCTTCTCATTCTCTGACTCTG
Reverse Primer AGCTGGGCTGAGAAAAAACA
 

Region

Nucleotide Sequences
GenBank Nucleotide AC118839 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
731173Uae22Urinary albumin excretion QTL 2210.1urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
2290393Uae37Urinary albumin excretion QTL 370.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
724536Uae7Urinary albumin excretion QTL 73.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)672202632130729475Rat
1331799Bp211Blood pressure QTL 2113.66407arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)672202632130919985Rat
1581550Pur8Proteinuria QTL 8urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)672227641130729205Rat
1581563Uae33Urinary albumin excretion QTL 33urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)672227641130729205Rat
738034Anxrr5Anxiety related response QTL 55.9exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)684130881129130881Rat
10054138Gmadr3Adrenal mass QTL 33.680.00045adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)685140138130140138Rat
10054123Srcrt6Stress Responsive Cort QTL 62.50.0043blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)685140138130140138Rat
724513Uae14Urinary albumin excretion QTL 146.5urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)685311061133478515Rat
1300076Glom8Glomerulus QTL 870.000000009kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)686894788131894788Rat
2303624Vencon5Ventilatory control QTL 54.45respiration trait (VT:0001943)minute ventilation (CMO:0000132)688047916133047916Rat
1331725Bp212Blood pressure QTL 2123.52475arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)693701310128713626Rat
61414Pia3Pristane induced arthritis QTL 34.5joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)694968928137848904Rat
12801411Schws8Schwannoma susceptibility QTL 8nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)694968928139968928Rat
8552796Vie3Viral induced encephalitis QTL 32.6brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)696833997140994061Rat
1358355Srcrt4Stress Responsive Cort QTL 46.39blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)6100364669140994061Rat
2313399Anxrr28Anxiety related response QTL 28aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)6100671796132340886Rat
1331797Bp213Blood pressure QTL 2133.291arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)6104085867128713626Rat
71111Iddm8Insulin dependent diabetes mellitus QTL 81.90.002blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)6105156861140994061Rat
4145118Mcs26Mammary carcinoma susceptibility QTL 260.0001mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)6106752656132339866Rat
737976Pia24Pristane induced arthritis QTL 24joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)6112636280140994061Rat
1298087Iddm18Insulin dependent diabetes mellitus QTL 180.0001urine glucose amount (VT:0001758)percentage of study population developing diabetes mellitus during a period of time (CMO:0001114)6116506292130245370Rat
1641917Colcr5Colorectal carcinoma resistance QTL 53.180.0009intestine integrity trait (VT:0010554)benign colorectal tumor number (CMO:0001795)6122549046137801795Rat
2293085Iddm29Insulin dependent diabetes mellitus QTL 297.66blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)6122549046140286318Rat
61329Eae9Experimental allergic encephalomyelitis QTL 93.7body mass (VT:0001259)change in body weight (CMO:0002045)6122549046140994061Rat
2312560Pur20Proteinuria QTL 202.10.005urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)6125628133137801795Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 24328 UniSTS
  326559 UniSTS
  691016 UniSTS
NCBI Nucleotide M95791
UniSTS 240531 UniSTS