Nppb<sup>em2Mcwi</sup> (natriuretic peptide B; zinc finger nuclease induced mutant 2, Medical College of Wisconsin) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Nppbem2Mcwi (natriuretic peptide B; zinc finger nuclease induced mutant 2, Medical College of Wisconsin) Rattus norvegicus
Analyze
Symbol: Nppbem2Mcwi
Name: natriuretic peptide B; zinc finger nuclease induced mutant 2, Medical College of Wisconsin
RGD ID: 5508324
Description: This allele was made by ZFN mutagenesis. The resulting mutation is a 100-bp deletion of part of intron 1 and exon 2 (del 165062746-165062845)
ASSOCIATED WITH cardiac hypertrophy; hypertension; increased urine protein level; ASSOCIATED WITH Hypertensive Nephropathy
Type: allele  of Nppb  
Previously known as: Nppb^[em2Mcwi]; Nppbem2Mcwi
Is Marker For: Strains:   SS-Nppbem2Mcwi   SS-Nppbem2Mcwi-/-  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position:
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Cytogenetic Map5 RGD


Disease Annotations     Click to see Annotation Detail View

Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype
References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. B-Type Natriuretic Peptide Deletion Leads to Progressive Hypertension, Associated Organ Damage, and Reduced Survival: Novel Model for Human Hypertension. Holditch SJ, etal., Hypertension. 2015 Jul;66(1):199-210. doi: 10.1161/HYPERTENSIONAHA.115.05610. Epub 2015 May 11.
3. PhysGen Knockouts PhysGen Knockout strains

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Nppbem2Mcwi-var1 chr5 164796229 164797531 GCGAGACAAGAGAGAGCAGGACACCATCGCAGCTGCCTGGCCCATCACTTCTGCAGCATGGATCTCCAGAAGGTGCTGCCCCAGATGATTCTGCTCCTGCTTTTCCTTAATCTGTCGCCGCTGGGAGGTCACTCCCATCCCCTGGGAAGTCCTAGCCAGTCTCCAGAACAATCCACGATGCAGGTGAGCACCGAGGGTCTGCATAGGGAGATGGAGCCTGCCTGAAGGGTTTTGGGCAGCAGCAATGAAAAGACCTCATGTCCTTTGGGAATTAACCACGCGAGAGTCAGGAAACGGAAAGATTGGGCAGCAGATCCCTTAACCGACAGGCACTGTGGAAGGGTGGGGGAGCCAGGTGTGTATGTGTGTGTGTGTCTGAGGTCTGGGCTTCCCAATTCGTCACAGAAGCTGCTGGAGCTGATAAGAGAAAAGTCAGAGGAAATGGCTCAGAGACAGCTCTCAAAGGACCAAGGCCCTACAAAAGAACTTCTAAAAAGAGTCCTTAGGTCTCAAGACAGCGCCTTCCGGATCCAGGAGAGACTTCGAAATTCCAAGATGGCACATAGTTCAAGCTGCTTTGGGCAGAAGATAGACCGGATTGGCGCAGTCAGTCGTTTGGGCTGTGACGGTGAGCACCTACCTTGCCGCTTCCCTGCAAAGCTGCACGCATCCCGTTCCCCTGCATGCCGCCCTCAGAGGCCCCTTGGTTTGCTCTCAGACATACTTGCACAGCCTGCCTCTACCTTACCGACAGTCTTCAAGACCAAGGCAGTCTGTCAGGAAGTCTCACATGGGTACTTCATTACACCGTCCCAGGTGAGCACCTACCTCCTTCAGAGGTGTCACAGGCTTCCCAGGGAACAGACTGCCTGATGTCTGATCACTCTGAGCATCTCCCCTCCGTCTTCACCAAACTGAATTATCCGAGGCAAAGGGCAGGCCCAGTGAGATAGCTTTTCCCAGAGCCGTTAAACTTCGACATCATCTGGGAACCAAAGATGGGGGTGCGGTGTGGCAGGGGAAGCTCAGCTCCTGCCTCAGTTTCACTCCCCAGTCTGACACTGGTTTCTCCTCCCCACAGGGCTGAGGTTGTTTTAGGAAGACCTCCTGGCTGCAGACTCTGGCTTCTGACTCTGCCTGCGGCTCTTCTTTCCCCAGCTCTGGGACCACCTCTCAAGTGATCCTGTTTATTTATTTGTTTATTTATTTATTTTTATGTTGCTGATTTTCTACAAGACTGTTTCTTATCTTCCAGCACAAACTTGCCACAGTGTAATAAACATAGCCTATTTCTTGCTTTTGG - deletion Rnor_6.0

Related Rat Strains
The following Strains have been annotated to Nppbem2Mcwi


Expression


Sequence

Nucleotide Sequences
GenBank Nucleotide NM 031545 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information