Nppa<sup>em4Mcwi</sup> (natriuretic peptide precursor A; zinc finger nuclease induced mutant 4, Medical College of Wisconsin) - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)
Gene: Nppaem4Mcwi (natriuretic peptide precursor A; zinc finger nuclease induced mutant 4, Medical College of Wisconsin) Rattus norvegicus
Analyze
Symbol: Nppaem4Mcwi
Name: natriuretic peptide precursor A; zinc finger nuclease induced mutant 4, Medical College of Wisconsin
RGD ID: 4139857
Description: This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 22-bp frameshift deletion in exon 2 (del 252-273).
Type: allele  of Nppa  
Previously known as: Nppa^[em4Mcwi]; Nppaem4Mcwi
Is Marker For: Strains:   SS-Nppaem4Mcwi  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position:
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Cytogenetic Map5 RGD


References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Nppaem4Mcwi-var1 chr5 164808762 164808783 CGCAGGCCCTGAGCGAGCAGAC - deletion Rnor_6.0

Related Rat Strains
The following Strains have been annotated to Nppaem4Mcwi
SS-Nppaem4Mcwi    


Expression

RNA-SEQ Expression


Sequence

Nucleotide Sequences
RefSeq Transcripts NM_012612 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information