Mir124-2 (microRNA 124-2) - Rat Genome Database

Name: Mir124-2
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir124-2 (microRNA 124-2) Rattus norvegicus

Analyze

Symbol:

Mir124-2

Name:

microRNA 124-2

RGD ID:

2325576

Description:

Predicted to enable mRNA binding activity. Predicted to act upstream of or within several processes, including miRNA-mediated gene silencing; nervous system development; and positive regulation of exit from mitosis. Predicted to be part of RISC complex. Orthologous to human MIR124-2 (microRNA 124-2); INTERACTS WITH arsenite(3-) (ortholog); benzo[a]pyrene (ortholog).

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

microRNA mir-124-2; rno-mir-124-2

RGD Orthologs

Human

Mouse

Dog

Pig

Alliance Genes

More Info

more info ...

Latest Assembly:

mRatBN7.2 - mRatBN7.2 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	2	100,134,866 - 100,134,974 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	2	100,134,866 - 100,134,974 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	2	106,657,424 - 106,657,532 (+)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	2	104,778,520 - 104,778,628 (+)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	2	99,788,130 - 99,788,238 (+)	NCBI	Rnor_WKY
Rnor_6.0	2	102,311,603 - 102,311,711 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	2	102,311,603 - 102,311,711 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	2	122,049,028 - 122,049,136 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	2	95,558,680 - 95,558,788 (+)	NCBI		Celera
Cytogenetic Map	2	q24	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

arsenite(3-) (ISO)

benzo[a]pyrene (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

axon extension (ISO)

central nervous system development (ISO)

miRNA-mediated gene silencing (ISO)

neuron apoptotic process (ISO)

positive regulation of exit from mitosis (ISO)

positive regulation of neurogenesis (ISO)

positive regulation of neuron projection development (ISO)

regulation of gene expression (ISO)

retinal cone cell development (ISO)

Cellular Component

RISC complex (ISO)

Molecular Function

mRNA binding (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:14691248	PMID:15345052	PMID:16381832	PMID:17403776	PMID:17604727	PMID:19536157	PMID:19898466	PMID:20403161	PMID:21857657	PMID:26071557	PMID:26823764	PMID:26947066
PMID:30480807	PMID:31210282	PMID:31378908	PMID:32142864	PMID:32272965	PMID:32918278	PMID:33026076	PMID:34146302	PMID:35753367	PMID:36768614

Genomics

Comparative Map Data

Mir124-2
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	2	100,134,866 - 100,134,974 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	2	100,134,866 - 100,134,974 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	2	106,657,424 - 106,657,532 (+)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	2	104,778,520 - 104,778,628 (+)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	2	99,788,130 - 99,788,238 (+)	NCBI	Rnor_WKY
Rnor_6.0	2	102,311,603 - 102,311,711 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	2	102,311,603 - 102,311,711 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	2	122,049,028 - 122,049,136 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	2	95,558,680 - 95,558,788 (+)	NCBI		Celera
Cytogenetic Map	2	q24	NCBI

MIR124-2
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	8	64,379,149 - 64,379,257 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p13 Ensembl	8	64,379,149 - 64,379,257 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	8	65,291,706 - 65,291,814 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	8	65,454,259 - 65,454,367 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	8	61,281,708 - 61,281,816 (+)	NCBI		Celera
Cytogenetic Map	8	q12.3	NCBI
HuRef	8	60,781,926 - 60,782,034 (+)	NCBI		HuRef
CHM1_1	8	65,345,418 - 65,345,526 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	8	64,804,556 - 64,804,664 (+)	NCBI		T2T-CHM13v2.0

Mir124a-2
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	3	17,849,826 - 17,849,934 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	3	17,849,826 - 17,849,934 (+)	Ensembl		GRCm39 Ensembl
GRCm38	3	17,795,662 - 17,795,770 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	3	17,795,662 - 17,795,770 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	3	17,695,662 - 17,695,770 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	3	17,786,367 - 17,786,475 (+)	NCBI		Celera
Cytogenetic Map	3	A1	NCBI

MIR124-2
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	29	14,264,389 - 14,264,445 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
Dog10K_Boxer_Tasha	29	14,587,556 - 14,587,612 (+)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	29	14,362,154 - 14,362,210 (+)	NCBI		ROS_Cfam_1.0
UMICH_Zoey_3.1	29	14,375,062 - 14,375,118 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	29	14,489,374 - 14,489,430 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	29	14,756,640 - 14,756,696 (+)	NCBI		UU_Cfam_GSD_1.0

MIR124A-1
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	4	69,968,854 - 69,968,958 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	4	69,968,854 - 69,968,958 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	4	76,136,453 - 76,136,557 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
61355	Bp36	Blood pressure QTL 36	2.9		blood pressure trait (VT:0000183)	systolic blood pressure (CMO:0000004)	2	5873687	102844969	Rat
1302794	Stl27	Serum triglyceride level QTL 27	4.4	0.0001	blood triglyceride amount (VT:0002644)	plasma triglyceride level (CMO:0000548)	2	25413423	143657569	Rat
1358894	Kidm24	Kidney mass QTL 24	4.03		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	25413423	157142209	Rat
1358899	Kidm23	Kidney mass QTL 23	3.88		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	25413423	157142209	Rat
1358901	Cm38	Cardiac mass QTL 38	2		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	157142209	Rat
1358904	Cm39	Cardiac mass QTL 39	2.26		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	157142209	Rat
1358910	Kidm27	Kidney mass QTL 27	5.77		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	25413423	157142209	Rat
1358911	Kidm28	Kidney mass QTL 28	5.42		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	25413423	157142209	Rat
1358913	Cm41	Cardiac mass QTL 41	2.73		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	203928301	Rat
1358917	Cm42	Cardiac mass QTL 42	2.82		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	203928301	Rat
1358887	Bw50	Body weight QTL 50	2.39		body mass (VT:0001259)	body weight (CMO:0000012)	2	25413652	157142078	Rat
1358908	Bw49	Body weight QTL 49	3.36		body mass (VT:0001259)	body weight (CMO:0000012)	2	25413652	157142078	Rat
1354603	Bp243	Blood pressure QTL 243	3.9		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	2	26917817	127469484	Rat
2290453	Scl55	Serum cholesterol level QTL 55	2.83		blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	2	26917817	136917119	Rat
70174	BpQTLCluster2	Blood pressure QTL cluster 2	4.24		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	2	40067944	102785628	Rat
70174	BpQTLCluster2	Blood pressure QTL cluster 2	4.24		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	40067944	102785628	Rat
70174	BpQTLCluster2	Blood pressure QTL cluster 2	4.24		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	40067944	102785628	Rat
70174	BpQTLCluster2	Blood pressure QTL cluster 2	4.24		arterial blood pressure trait (VT:2000000)	pulse pressure (CMO:0000292)	2	40067944	102785628	Rat
70174	BpQTLCluster2	Blood pressure QTL cluster 2	4.24		arterial blood pressure trait (VT:2000000)	absolute change in mean arterial blood pressure (CMO:0000533)	2	40067944	102785628	Rat
2293835	Kiddil5	Kidney dilation QTL 5	3.8		kidney pelvis morphology trait (VT:0004194)	hydronephrosis severity score (CMO:0001208)	2	42804607	157142209	Rat
2293843	Kiddil6	Kidney dilation QTL 6	3.1		kidney pelvis morphology trait (VT:0004194)	hydronephrosis severity score (CMO:0001208)	2	42804607	182042367	Rat
1298074	Bp164	Blood pressure QTL 164		0.003	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	42804607	202447032	Rat
1298085	Bp165	Blood pressure QTL 165		0.0006	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	42804607	202447032	Rat
61467	Bp14	Blood pressure QTL 14	2.2		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	2	43154682	202446871	Rat
61467	Bp14	Blood pressure QTL 14	2.2		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	43154682	202446871	Rat
2293676	Bmd19	Bone mineral density QTL 19	10.7	0.0001	femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	2	43162366	111362592	Rat
2293682	Bmd24	Bone mineral density QTL 24	8.9	0.0001	femur mineral mass (VT:0010011)	compact volumetric bone mineral density (CMO:0001730)	2	43162366	111362592	Rat
2293671	Bss44	Bone structure and strength QTL 44	10.97	0.0001	lumbar vertebra morphology trait (VT:0010494)	lumbar vertebra cortical cross-sectional area (CMO:0001690)	2	43162366	148478373	Rat
1354601	Slep1	Serum leptin concentration QTL 1	5.39		blood leptin amount (VT:0005667)	serum leptin level (CMO:0000780)	2	43171017	184114403	Rat
631266	Bp132	Blood pressure QTL 132		0.0005	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	46123260	202447032	Rat
1331760	Bp206	Blood pressure QTL 206	3.62454		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	56043031	202447032	Rat
1558648	Smcn1	Smooth muscle cell number QTL 1		0.039	blood vessel smooth muscle cell quantity (VT:0010525)	aorta smooth muscle cell count per unit vessel length (CMO:0001646)	2	59134147	127460910	Rat
5684990	Bmd82	Bone mineral density QTL 82	2.8		tibia mineral mass (VT:1000283)	bone mineral content (CMO:0001554)	2	59324377	103795077	Rat
5684996	Bmd85	Bone mineral density QTL 85	4.7	0.024	tibia mineral mass (VT:1000283)	bone mineral density (CMO:0001226)	2	59324377	103795077	Rat
61438	Cia7	Collagen induced arthritis QTL 7	4.6	0.0001	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	2	59324377	141596857	Rat
631500	Bp99	Blood pressure QTL 99	2.5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	59324719	102755241	Rat
1578777	Stresp15	Stress response QTL 15	2	0.05	blood aldosterone amount (VT:0005346)	plasma aldosterone level (CMO:0000551)	2	59846005	104846005	Rat
2306903	Bp336	Blood pressure QTL 336		0.01	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	64366971	109366971	Rat
1298080	Bp163	Blood pressure QTL 163		0.02	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	66118275	202447032	Rat
1354648	Bp239	Blood pressure QTL 239		0.001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	66118463	226797303	Rat
7411551	Bw131	Body weight QTL 131	29.6	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	2	67942638	112942638	Rat
1558653	Prcr1	Prostate cancer resistance QTL 1	5		prostate integrity trait (VT:0010571)	area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899)	2	72532993	157142209	Rat
1354605	Rf48	Renal function QTL 48	2.9		blood creatinine amount (VT:0005328)	plasma creatinine level (CMO:0000537)	2	74786664	206665859	Rat
61465	Bp13	Blood pressure QTL 13	3.3		blood pressure trait (VT:0000183)	diastolic blood pressure (CMO:0000005)	2	76539322	102785628	Rat
61465	Bp13	Blood pressure QTL 13	3.3		blood pressure trait (VT:0000183)	systolic blood pressure (CMO:0000004)	2	76539322	102785628	Rat
631198	Cm22	Cardiac mass QTL 22	4.3	0.0008	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	2	76539322	150540526	Rat
61374	Edpm2	Estrogen-dependent pituitary mass QTL 2	4.42	0.86	pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	2	76539322	202447032	Rat
2299162	Iddm32	Insulin dependent diabetes mellitus QTL 32	2.36		blood glucose amount (VT:0000188)	age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)	2	78665616	143657569	Rat
1581569	Uae32	Urinary albumin excretion QTL 32		0.0001	urine protein amount (VT:0005160)	urine albumin excretion rate (CMO:0000757)	2	78665619	219826953	Rat
724534	Uae6	Urinary albumin excretion QTL 6	10		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	2	78665619	249053267	Rat
61392	Bp6	Blood pressure QTL 6	7		arterial blood pressure trait (VT:2000000)	pulse pressure (CMO:0000292)	2	80270434	125270434	Rat
1598865	Bp296	Blood pressure QTL 296	2.1		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	81018907	126018907	Rat
8662832	Vetf7	Vascular elastic tissue fragility QTL 7	3.5		aorta elastin amount (VT:0003905)	aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)	2	81689826	221035911	Rat
1354622	Kidm16	Kidney mass QTL 16	3		kidney mass (VT:0002707)	left kidney wet weight (CMO:0000083)	2	81754530	222436696	Rat
1354649	Kidm17	Kidney mass QTL 17	2.9		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	2	81754530	227146641	Rat
1578772	Stresp14	Stress response QTL 14	5	0.001	blood renin amount (VT:0003349)	plasma renin activity level (CMO:0000116)	2	82345893	130923501	Rat
7207808	Bmd89	Bone mineral density QTL 89	4.1		femur strength trait (VT:0010010)	femoral neck ultimate force (CMO:0001703)	2	88862519	133862519	Rat
2300165	Bmd49	Bone mineral density QTL 49	4.8	0.0001	lumbar vertebra mineral mass (VT:0010511)	bone mineral density (CMO:0001226)	2	88862519	133862519	Rat
2300170	Bmd45	Bone mineral density QTL 45	12.1	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	2	88862519	133862519	Rat
2300185	Bmd46	Bone mineral density QTL 46	8.4	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	2	88862519	133862519	Rat
1598862	Glom9	Glomerulus QTL 9	3.5		kidney glomerulus morphology trait (VT:0005325)	index of glomerular damage (CMO:0001135)	2	92337601	137337601	Rat
1598863	Cm65	Cardiac mass QTL 65	2.3		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	92337601	137337601	Rat

Markers in Region

RH143901

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	2	100,134,296 - 100,134,493 (+)	MAPPER	mRatBN7.2
Rnor_6.0	2	102,311,034 - 102,311,230	NCBI	Rnor6.0
Rnor_5.0	2	122,048,459 - 122,048,655	UniSTS	Rnor5.0
RGSC_v3.4	2	102,698,897 - 102,699,093	UniSTS	RGSC3.4
Celera	2	95,558,111 - 95,558,307	UniSTS
RH 3.4 Map	2	606.8	UniSTS

Mirn124a-2

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	2	100,134,865 - 100,134,969 (+)	MAPPER	mRatBN7.2
Rnor_6.0	2	102,311,603 - 102,311,706	NCBI	Rnor6.0
Rnor_5.0	2	122,049,028 - 122,049,131	UniSTS	Rnor5.0
RGSC_v3.4	2	102,699,466 - 102,699,569	UniSTS	RGSC3.4
Celera	2	95,558,680 - 95,558,783	UniSTS

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

	nervous system	reproductive system
High
Medium	32
Low	42	2
Below cutoff		2

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_031867	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JACYVU010000067	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSRNOT00000053622

RefSeq Status:

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	2	100,134,866 - 100,134,974 (+)	Ensembl
Rnor_6.0 Ensembl	2	102,311,603 - 102,311,711 (+)	Ensembl

RefSeq Acc Id:

NR_031867

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2	2	100,134,866 - 100,134,974 (+)	NCBI
Rnor_6.0	2	102,311,603 - 102,311,711 (+)	NCBI
Rnor_5.0	2	122,049,028 - 122,049,136 (+)	NCBI
Celera	2	95,558,680 - 95,558,788 (+)	NCBI

Sequence:

show sequence

ATCAAGATCAGAGACTCTGCTCTCCGTGTTCACAGCGGACCTTGATTTAATGTCATACAATTAA
GGCACGCGGTGAATGCCAAGAGCGGAGCCTACGGCTGCACTTGAA

hide sequence

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:2325576	AgrOrtholog
BioCyc Gene	G2FUF-53643	BioCyc
Ensembl Genes	ENSRNOG00000035499	Ensembl, ENTREZGENE
Ensembl Transcript	ENSRNOT00000053622	ENTREZGENE
miRBase	MI0000894	ENTREZGENE
NCBI Gene	100314024	ENTREZGENE
PhenoGen	Mir124-2	PhenoGen
RNAcentral	URS000020BE6A	RNACentral
	URS00003AA409	RNACentral
	URS000075E86C	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2013-08-14	Mir124-2	microRNA 124-2	Mir124-2	microRNA mir-124-2	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2010-06-02	Mir124-2	microRNA mir-124-2			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message