Advanced Search (OLGA)

Gene: Mir200a (microRNA 200a) Rattus norvegicus

Analyze

Symbol:

Mir200a

Name:

microRNA 200a

RGD ID:

2325426

Description:

Enables mRNA base-pairing post-transcriptional repressor activity. Involved in cellular response to amyloid-beta; miRNA-mediated post-transcriptional gene silencing; and positive regulation of neuron apoptotic process. Predicted to be part of RISC complex. Biomarker of liver cirrhosis. Orthologous to human MIR200A (microRNA 200a); INTERACTS WITH 2-acetamidofluorene; aflatoxin B1; benzophenone.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Previously known as:

rno-mir-200a

RGD Orthologs

Human

Mouse

Dog

Alliance Orthologs

More Info

more info ...

Latest Assembly:

GRCr8 - GRCr8 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	5	171,930,717 - 171,930,805 (-)	NCBI	GRCr8	GRCr8		GRCr8
mRatBN7.2	5	166,648,494 - 166,648,582 (-)	NCBI	mRatBN7.2	mRatBN7.2
UTH_Rnor_SHR_Utx	5	169,352,034 - 169,352,122 (-)	NCBI	UTH_Rnor_SHR_Utx	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	5	171,173,456 - 171,173,544 (-)	NCBI	UTH_Rnor_SHRSP_BbbUtx_1.0	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	5	171,135,990 - 171,136,078 (-)	NCBI	UTH_Rnor_WKY_Bbb_1.0	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	5	173,489,366 - 173,489,454 (-)	NCBI	Rnor_6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_5.0	5	176,963,388 - 176,963,476 (-)	NCBI	Rnor_5.0	Rnor_5.0	rn5
Celera	5	164,849,297 - 164,849,385 (-)	NCBI		Celera
Cytogenetic Map	5	q36	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

colorectal cancer (ISO)

liver cirrhosis (IEP)

Lung Agenesis (ISO)

pancreatitis (ISO)

Pulmonary Arterial Hypertension (IEP)

type 2 diabetes mellitus (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1,3,5-trinitro-1,3,5-triazinane (ISO)

17beta-estradiol (ISO)

17beta-hydroxy-5alpha-androstan-3-one (ISO)

2,3,7,8-tetrachlorodibenzodioxine (ISO)

2,5-dihydroxybenzoic acid (ISO)

2-acetamidofluorene (EXP)

aflatoxin B1 (EXP)

aldehydo-D-glucose (ISO)

arsane (ISO)

arsenic atom (ISO)

arsenite(3-) (ISO)

benzophenone (EXP)

bis(2-ethylhexyl) phthalate (EXP,ISO)

bisphenol A (ISO)

bleomycin A2 (EXP)

boric acid (ISO)

buta-1,3-diene (ISO)

cadmium dichloride (ISO)

carbon atom (ISO)

carvedilol (EXP)

chlorendic acid (EXP)

chromium(6+) (ISO)

cisplatin (EXP)

D-glucose (ISO)

dehydroepiandrosterone (ISO)

Diosbulbin B (ISO)

dioxygen (ISO)

elemental carbon (ISO)

ethanol (ISO)

fenhexamid (ISO)

ferulic acid (EXP)

fludioxonil (ISO)

furan (EXP)

gallic acid (EXP)

glucose (ISO)

GSK-J4 (ISO)

hexanal (EXP)

icariin (ISO)

isoprenaline (EXP)

L-methionine (ISO)

Licochalcone B (ISO)

lutein (EXP)

mechlorethamine (EXP)

melatonin (EXP)

metformin (ISO)

methanol (ISO)

methapyrilene (EXP)

methimazole (ISO)

monocrotaline (EXP)

N-methyl-4-phenylpyridinium (EXP,ISO)

nicotinamide (ISO)

paracetamol (EXP)

phenobarbital (EXP)

reserpine (ISO)

rifampicin (ISO)

rotenone (EXP)

S-butyl-DL-homocysteine (S,R)-sulfoximine (ISO)

silver atom (ISO)

silver(0) (ISO)

sodium arsenite (ISO)

sodium fluoride (EXP)

streptozocin (ISO)

tetrachloromethane (EXP,ISO)

thioacetamide (EXP)

wortmannin (ISO)

zearalenone (ISO)

zinc atom (EXP,ISO)

zinc(0) (EXP,ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to ethanol (ISO)

cellular response to glucose stimulus (ISO)

cellular response to leukemia inhibitory factor (ISO)

interneuron axon guidance (ISO)

miRNA-mediated post-transcriptional gene silencing (ISO)

olfactory bulb interneuron differentiation (ISO)

positive regulation of blood vessel endothelial cell migration (ISO)

regulation of insulin secretion involved in cellular response to glucose stimulus (ISO)

response to alkaloid (IEP)

response to hormone (IEP)

sensory perception of sound (ISO)

Wnt signaling pathway (ISO)

Molecular Function

mRNA base-pairing post-transcriptional repressor activity (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Gli3 is a novel downstream target of miR‑200a with an anti‑ﬁbrotic role for progression of liver fibrosis in vivo and in vitro.	Li L, etal., Mol Med Rep. 2020 Apr;21(4):1861-1871. doi: 10.3892/mmr.2020.10997. Epub 2020 Feb 21.
2.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions
3.	Identifying Involvement of H19-miR-675-3p-IGF1R and H19-miR-200a-PDCD4 in Treating Pulmonary Hypertension with Melatonin.	Wang R, etal., Mol Ther Nucleic Acids. 2018 Dec 7;13:44-54. doi: 10.1016/j.omtn.2018.08.015. Epub 2018 Aug 24.

Additional References at PubMed

PMID:16381832	PMID:16682203	PMID:16766679	PMID:19091803	PMID:20403161	PMID:20417623	PMID:20439489	PMID:22012804	PMID:23646144	PMID:23857252	PMID:24242045	PMID:25049078
PMID:25937343	PMID:25966629	PMID:26466330	PMID:26499180	PMID:27121251	PMID:27433802	PMID:28025657	PMID:28281184	PMID:29264965	PMID:29358553	PMID:29486902	PMID:30248538
PMID:30888602	PMID:31651553	PMID:32004541	PMID:33048239	PMID:33444919	PMID:33638775	PMID:35778809	PMID:37171465	PMID:37179212	PMID:37565555

Genomics

Comparative Map Data

Mir200a
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	5	171,930,717 - 171,930,805 (-)	NCBI	GRCr8	GRCr8		GRCr8
mRatBN7.2	5	166,648,494 - 166,648,582 (-)	NCBI	mRatBN7.2	mRatBN7.2
UTH_Rnor_SHR_Utx	5	169,352,034 - 169,352,122 (-)	NCBI	UTH_Rnor_SHR_Utx	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	5	171,173,456 - 171,173,544 (-)	NCBI	UTH_Rnor_SHRSP_BbbUtx_1.0	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	5	171,135,990 - 171,136,078 (-)	NCBI	UTH_Rnor_WKY_Bbb_1.0	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	5	173,489,366 - 173,489,454 (-)	NCBI	Rnor_6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_5.0	5	176,963,388 - 176,963,476 (-)	NCBI	Rnor_5.0	Rnor_5.0	rn5
Celera	5	164,849,297 - 164,849,385 (-)	NCBI		Celera
Cytogenetic Map	5	q36	NCBI

MIR200A
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	1	1,167,863 - 1,167,952 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	1	1,167,863 - 1,167,952 (+)	Ensembl			hg38	GRCh38
GRCh37	1	1,103,243 - 1,103,332 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	1	1,093,105 - 1,093,194 (+)	NCBI	Build 36	Build 36	hg18	NCBI36
Celera	1	1,479,492 - 1,479,581 (-)	NCBI		Celera
Cytogenetic Map	1	p36.33	NCBI
HuRef	1	374,624 - 374,713 (+)	NCBI		HuRef
CHM1_1	1	1,090,213 - 1,090,302 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	1	596,460 - 596,549 (+)	NCBI		T2T-CHM13v2.0

Mir200a
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	4	156,139,353 - 156,139,442 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	4	156,139,353 - 156,139,442 (-)	Ensembl		GRCm39 Ensembl		GRCm39
GRCm38	4	156,054,896 - 156,054,985 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	4	156,054,896 - 156,054,985 (-)	Ensembl			mm10	GRCm38
MGSCv37	4	155,429,005 - 155,429,094 (-)	NCBI	MGSCv37	MGSCv37	mm9	NCBIm37
Celera	4	158,317,292 - 158,317,381 (-)	NCBI		Celera
Cytogenetic Map	4	E2	NCBI
cM Map	4	87.96	NCBI

MIR200A
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	5	56,369,063 - 56,369,152 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	5	56,369,061 - 56,369,151 (-)	Ensembl			canFam3	CanFam3.1
Dog10K_Boxer_Tasha	5	56,446,057 - 56,446,146 (+)	NCBI	Dog10K_Boxer_Tasha	Dog10K_Boxer_Tasha
ROS_Cfam_1.0	5	56,571,960 - 56,572,049 (+)	NCBI	ROS_Cfam_1.0	ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	5	56,571,958 - 56,572,048 (-)	Ensembl				ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	5	56,562,727 - 56,562,816 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	5	56,454,985 - 56,455,074 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	5	56,844,978 - 56,845,067 (+)	NCBI	UU_Cfam_GSD_1.0	UU_Cfam_GSD_1.0

miRNA Target Status (No longer updated)

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Zeb2	rno-miR-200a-3p	Mirtarbase	external_info	Western blot	Functional MTI	19167416

Predicted Targets

	Summary Value
Count of predictions:	5508
Count of gene targets:	3752
Count of transcripts:	4009
Interacting mature miRNAs:	rno-miR-200a-3p, rno-miR-200a-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (GRCr8)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1576312	Emca8	Estrogen-induced mammary cancer QTL 8	4.1		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	55124766	172190305	Rat
10053720	Scort26	Serum corticosterone level QTL 26	2.06	0.0147	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	5	130249266	172190305	Rat
1354583	Despr3	Despair related QTL3	4.98	0.0002	locomotor behavior trait (VT:0001392)	amount of time spent in voluntary immobility (CMO:0001043)	5	132930505	172190305	Rat
61444	Strs2	Sensitivity to stroke QTL 2	4.7		cerebrum integrity trait (VT:0010549)	post-insult time to onset of cerebrovascular lesion (CMO:0002343)	5	141212838	172190305	Rat
724525	Bp147	Blood pressure QTL 147	4.3	0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	131708216	172190305	Rat
61452	Ciaa5	CIA Autoantibody QTL 5	3.5		blood autoantibody amount (VT:0003725)	calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)	5	99905133	172190305	Rat
8552908	Pigfal4	Plasma insulin-like growth factor 1 level QTL 4	6.6		blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	5	133789363	172190305	Rat
1331803	Rf32	Renal function QTL 32	2.798		kidney blood vessel physiology trait (VT:0100012)	absolute change in renal vascular resistance (CMO:0001900)	5	134369199	172190305	Rat
7794791	Mcs33	Mammary carcinoma susceptibility QTL 33	1.93		mammary gland integrity trait (VT:0010552)	mammary tumor incidence/prevalence measurement (CMO:0000946)	5	136631198	172190305	Rat
1354631	Swd2	Spike wave discharge measurement QTL 2	3.64	0.0002	brain electrophysiology trait (VT:0010557)	brain total spike-and-wave discharge duration (CMO:0001740)	5	156396728	172190305	Rat
1598861	Cm64	Cardiac mass QTL 64	2.9		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	5	133081618	172190305	Rat
1581505	Rf54	Renal function QTL 54			kidney physiology trait (VT:0002136)	kidney 20-HETE level (CMO:0001854)	5	133270647	172190305	Rat
1641920	Colcs1	Colorectal carcinoma susceptibility QTL 1	2.99	0.0055	intestine integrity trait (VT:0010554)	benign colorectal tumor surface area measurement (CMO:0001799)	5	160071170	172129029	Rat
2317753	Glom24	Glomerulus QTL 24	3.1		kidney glomerulus integrity trait (VT:0010546)	kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)	5	141764300	172190305	Rat
1598819	Bp292	Blood pressure QTL 292	4.3		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	133081618	172190305	Rat
1331721	Bp210	Blood pressure QTL 210	3.413		arterial blood pressure trait (VT:2000000)	blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)	5	148093485	172129029	Rat
8694169	Bw148	Body weight QTL 148	5	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	5	133789363	172190305	Rat
1581510	Cm54	Cardiac mass QTL 54	3.4	0.05	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	5	125969677	172190305	Rat

Expression

RNA-SEQ Expression

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_031916	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC097183	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAXUCZ010000005	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

NR_031916

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	5	171,930,717 - 171,930,805 (-)	NCBI
mRatBN7.2	5	166,648,494 - 166,648,582 (-)	NCBI
Rnor_6.0	5	173,489,366 - 173,489,454 (-)	NCBI
Rnor_5.0	5	176,963,388 - 176,963,476 (-)	NCBI
Celera	5	164,849,297 - 164,849,385 (-)	NCBI

Sequence:

show sequence

CTGGGCCTCTGTGGGCATCTTACCGGACAGTGCTGGATTTCTTGGCTTGACTCTAACACTGTCT
GGTAACGATGTTCAAAGGTGACCCA

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:2325426	AgrOrtholog
BioCyc Gene	G2FUF-38867	BioCyc
miRBase	MI0000943	ENTREZGENE
NCBI Gene	100314194	ENTREZGENE
PhenoGen	Mir200a	PhenoGen
RNAcentral	URS000008DA94	RNACentral
	URS0000759D1E	RNACentral
	URS000075DB8F	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2015-04-09	Mir200a	microRNA 200a	Mir200a	microRNA mir-200a	Name updated	61478	APPROVED

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - CTD