Mir365b (microRNA 365b) - Rat Genome Database

Name: Mir365b
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir365b (microRNA 365b) Rattus norvegicus

Analyze

Symbol:

Mir365b

Name:

microRNA 365b

RGD ID:

2325371

Description:

Predicted to enable mRNA base-pairing translational repressor activity. Predicted to be involved in miRNA-mediated gene silencing by inhibition of translation and negative regulation of interleukin-6 production. Predicted to act upstream of or within cellular response to amino acid stimulus; cellular response to leukemia inhibitory factor; and response to oxygen levels. Orthologous to human MIR365B (microRNA 365b); INTERACTS WITH aflatoxin B1; bleomycin A2; cisplatin.

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

microRNA 365; microRNA mir-365; Mir365; rno-mir-365

RGD Orthologs

Human

Mouse

Dog

Pig

Alliance Genes

More Info

more info ...

Latest Assembly:

mRatBN7.2 - mRatBN7.2 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	10	64,686,255 - 64,686,340 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	10	64,686,252 - 64,686,351 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	10	69,314,493 - 69,314,578 (+)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	10	68,819,888 - 68,819,973 (+)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	10	64,283,739 - 64,283,824 (+)	NCBI	Rnor_WKY
Rnor_6.0	10	67,079,796 - 67,079,881 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	10	67,079,796 - 67,079,881 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	10	64,570,072 - 64,570,157 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	10	63,655,085 - 63,655,170 (+)	NCBI		Celera
Cytogenetic Map	10	q25	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

hepatitis B (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

aflatoxin B1 (EXP)

bisphenol A (ISO)

bleomycin A2 (EXP)

chromium(6+) (ISO)

cisplatin (EXP)

hydrogen peroxide (ISO)

paclitaxel (ISO)

paracetamol (EXP)

Pirarubicin (EXP)

rutin (EXP)

sodium fluoride (ISO)

tamoxifen (EXP)

tetrachloromethane (EXP)

zinc atom (EXP)

zinc(0) (EXP)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to amino acid stimulus (ISO)

cellular response to leukemia inhibitory factor (ISO)

miRNA-mediated gene silencing (ISO)

miRNA-mediated gene silencing by inhibition of translation (ISO)

negative regulation of interleukin-6 production (ISO)

response to oxygen levels (ISO)

Molecular Function

mRNA base-pairing translational repressor activity (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:15735639	PMID:16381832	PMID:18723672	PMID:20403161	PMID:20439489	PMID:20548288	PMID:24819721	PMID:24936138	PMID:27922111	PMID:29415719	PMID:29451327	PMID:30977043
PMID:31276691	PMID:33852805	PMID:35325441

Genomics

Comparative Map Data

Mir365b
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	10	64,686,255 - 64,686,340 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	10	64,686,252 - 64,686,351 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	10	69,314,493 - 69,314,578 (+)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	10	68,819,888 - 68,819,973 (+)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	10	64,283,739 - 64,283,824 (+)	NCBI	Rnor_WKY
Rnor_6.0	10	67,079,796 - 67,079,881 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	10	67,079,796 - 67,079,881 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	10	64,570,072 - 64,570,157 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	10	63,655,085 - 63,655,170 (+)	NCBI		Celera
Cytogenetic Map	10	q25	NCBI

MIR365B
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	17	31,575,411 - 31,575,521 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p13 Ensembl	17	31,575,411 - 31,575,521 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	17	29,902,430 - 29,902,540 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	17	26,926,542 - 26,926,652 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	17	26,822,194 - 26,822,304 (+)	NCBI		Celera
Cytogenetic Map	17	q11.2	NCBI
HuRef	17	26,112,839 - 26,112,949 (+)	NCBI		HuRef
CHM1_1	17	29,965,075 - 29,965,185 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	17	32,521,187 - 32,521,297 (+)	NCBI		T2T-CHM13v2.0

Mir365-2
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	11	79,617,226 - 79,617,337 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	11	79,617,226 - 79,617,337 (+)	Ensembl		GRCm39 Ensembl
GRCm38	11	79,726,400 - 79,726,511 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	11	79,726,400 - 79,726,511 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	11	79,539,902 - 79,540,013 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	11	89,359,011 - 89,359,122 (+)	NCBI		Celera
Cytogenetic Map	11	B5	NCBI

MIR365-2
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	9	41,303,092 - 41,303,202 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	9	41,303,092 - 41,303,202 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	9	40,465,366 - 40,465,476 (-)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	9	42,123,714 - 42,123,824 (-)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	9	42,123,714 - 42,123,824 (-)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	9	40,907,921 - 40,908,031 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	9	41,202,731 - 41,202,841 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	9	41,278,468 - 41,278,578 (-)	NCBI		UU_Cfam_GSD_1.0

MIR365-2
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	12	43,324,728 - 43,324,809 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	12	43,324,725 - 43,324,804 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	12	45,152,792 - 45,152,871 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	9819
Count of gene targets:	6248
Count of transcripts:	6722
Interacting mature miRNAs:	rno-miR-365-3p, rno-miR-365-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
70188	BpQTLcluster1	Blood pressure QTL cluster 1	4.864		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	1	42323132	87323132	Rat
70188	BpQTLcluster1	Blood pressure QTL cluster 1	4.864		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	42323132	87323132	Rat
70188	BpQTLcluster1	Blood pressure QTL cluster 1	4.864		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	42323132	87323132	Rat
70188	BpQTLcluster1	Blood pressure QTL cluster 1	4.864		arterial blood pressure trait (VT:2000000)	pulse pressure (CMO:0000292)	1	42323132	87323132	Rat
70198	BpQTLcluster9	Blood pressure QTL cluster 9	2.94		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	42323132	87323132	Rat
70223	Bp57	Blood pressure QTL 57	5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	1	80676123	Rat
70363	Bp71	Blood pressure QTL 71		0.04	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	61345276	81714865	Rat
70364	Bp72	Blood pressure QTL 72			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	51121100	96121100	Rat
2303118	Mamtr7	Mammary tumor resistance QTL 7		0.003	mammary gland integrity trait (VT:0010552)	mammary tumor growth rate (CMO:0000344)	10	9658275	104670812	Rat
631267	Cia20	Collagen induced arthritis QTL 20	3.2		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	23444813	104060283	Rat
631268	Cia21	Collagen induced arthritis QTL 21	3.1		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	14487011	104060283	Rat
61449	Ciaa2	CIA Autoantibody QTL 2	7.1		blood autoantibody amount (VT:0003725)	calculated serum anti-type 2 collagen antibody titer (CMO:0001279)	10	63221094	107211142	Rat
61463	Bp12	Blood pressure QTL 12	6.3	0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	41333258	86333258	Rat
70164	Bw21	Body weight QTL 21	4.36	0.00005	body mass (VT:0001259)	body weight (CMO:0000012)	10	53797494	98952626	Rat
70171	Cari1	Carrageenan-induced inflammation QTL 1	4.9	0.0005	hypodermis integrity trait (VT:0010550)	inflammatory exudate volume (CMO:0001429)	10	53797385	107211142	Rat
61325	Aia5	Adjuvant induced arthritis QTL 5		0.01	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	23444813	104060283	Rat
724527	Bp148	Blood pressure QTL 148		0.0001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	28453136	73453136	Rat
724556	Pur2	Proteinuria QTL 2	5.5		urine protein amount (VT:0005160)	urine protein level (CMO:0000591)	10	22427500	90627625	Rat
1298069	Bp168	Blood pressure QTL 168	5.5		blood pressure trait (VT:0000183)	systolic blood pressure (CMO:0000004)	10	26521957	98003205	Rat
1298078	Stresp5	Stress response QTL 5	2.99	0.00025	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	10	42045676	104670812	Rat
631557	Bp136	Blood pressure QTL 136		0.003	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	30632053	75632053	Rat
1331791	Cm31	Cardiac mass QTL 31	3.84606		heart mass (VT:0007028)	heart wet weight (CMO:0000069)	10	29299504	107211142	Rat
1331839	Eae18b	Experimental allergic encephalomyelitis QTL 18b	5.8	0.03	nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis severity score (CMO:0001419)	10	61248303	67785171	Rat
2312662	Slep8	Serum leptin concentration QTL 8		0.05	blood leptin amount (VT:0005667)	serum leptin level (CMO:0000780)	10	57134272	102134272	Rat
2312668	Scl65	Serum cholesterol level QTL 65		0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	10	57134272	102134272	Rat
2312672	Insul15	Insulin level QTL 15		0.01	blood insulin amount (VT:0001560)	serum insulin level (CMO:0000358)	10	57134272	102134272	Rat
2306970	Anxrr22	Anxiety related response QTL 22	5.95		fear/anxiety-related behavior trait (VT:1000241)	number of periods of voluntary immobility (CMO:0001045)	10	61345276	98211570	Rat
631269	Cia22	Collagen induced arthritis QTL 22	8.9		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	40035094	104060283	Rat
631270	Cia23	Collagen induced arthritis QTL 23	3.9		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	40035094	104060283	Rat
631526	Bp76	Blood pressure QTL 76		0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	61345413	66743655	Rat
631530	Tls3	T-lymphoma susceptibility QTL 3	0	0.0001	thymus integrity trait (VT:0010555)	percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)	10	51774612	95600334	Rat
631535	Cm51	Cardiac mass QTL 51	3		heart mass (VT:0007028)	calculated heart weight (CMO:0000073)	10	51786282	91669536	Rat
631542	Bp82	Blood pressure QTL 82	6.8		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	26521957	98952741	Rat
631547	Bp87	Blood pressure QTL 87	4.5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	47369470	92369470	Rat
631552	Vetf2	Vascular elastic tissue fragility QTL 2	4.5	0.0002	aorta elastic tissue integrity trait (VT:0010556)	artery internal elastic lamina non-tumorous lesion count (CMO:0001913)	10	41142633	86142633	Rat
2300171	Bmd58	Bone mineral density QTL 58	4.9	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	10	26944628	71944628	Rat
2293652	Bmd22	Bone mineral density QTL 22	4.9	0.0001	femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	10	49444551	81709989	Rat
2293669	Bmd33	Bone mineral density QTL 33	4.5	0.0001	femur strength trait (VT:0010010)	femoral neck polar moment of inertia (CMO:0001670)	10	49444551	81709989	Rat
2293679	Bmd30	Bone mineral density QTL 30	3.5	0.0001	femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	10	49444551	81709989	Rat
2293698	Bss43	Bone structure and strength QTL 43	5.33	0.0001	lumbar vertebra size trait (VT:0010518)	lumbar vertebra cross-sectional area (CMO:0001689)	10	59209888	104209888	Rat
1576308	Schws1	Schwannoma susceptibility QTL 1		0.0041	nervous system integrity trait (VT:0010566)	percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)	10	40035094	102359817	Rat
1576311	Pia26	Pristane induced arthritis QTL 26			joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	31224026	75632053	Rat
1576319	Cia29	Collagen induced arthritis QTL 29			joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	33973921	78973921	Rat
1578779	Tcas10	Tongue tumor susceptibility QTL 10	3.12		tongue integrity trait (VT:0010553)	number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)	10	31297439	76297439	Rat
1354608	Cm33	Cardiac mass QTL 33	2.8		heart left ventricle mass (VT:0007031)	heart left ventricle wet weight (CMO:0000071)	10	54809292	99809292	Rat
2293705	Bmd25	Bone mineral density QTL 25	7.1	0.0001	femur mineral mass (VT:0010011)	compact volumetric bone mineral density (CMO:0001730)	10	49444551	81709989	Rat
2300218	Hpcl2	Hepatic cholesterol level QTL 2			liver cholesterol amount (VT:0010498)	liver cholesterol level (CMO:0001597)	10	45029650	95600334	Rat
2301967	Cm73	Cardiac mass QTL 73	4.55		heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	10	14487011	89062041	Rat
1359017	Hrtrt21	Heart rate QTL 21	2.4		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	10	51772940	96772940	Rat
1558643	Cm44	Cardiac mass QTL 44	4.8	0.0000368	heart mass (VT:0007028)	heart wet weight (CMO:0000069)	10	61345276	99703528	Rat
2316949	Gluco60	Glucose level QTL 60	3.7		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	10	14487011	107057807	Rat
2317042	Aia20	Adjuvant induced arthritis QTL 20	3.38		joint integrity trait (VT:0010548)	right rear ankle joint diameter (CMO:0002150)	10	37565079	82565079	Rat
2317043	Aia7	Adjuvant induced arthritis QTL 7	3.82		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	10	37565079	82565079	Rat
1549846	Scl47	Serum cholesterol level QTL 47	3.6		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	10	50574707	95574707	Rat
1554317	Bmd4	Bone mineral density QTL 4	9.4	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	10	19816042	99406971	Rat
2292441	Bp308	Blood pressure QTL 308			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	27606468	72606468	Rat
2313103	Bss80	Bone structure and strength QTL 80	2	0.0001	tibia strength trait (VT:1000284)	tibia midshaft endosteal cross-sectional area (CMO:0001716)	10	62057807	107057807	Rat
2313105	Bss79	Bone structure and strength QTL 79	1.8	0.0001	tibia size trait (VT:0100001)	tibia midshaft cross-sectional area (CMO:0001717)	10	62057807	107057807	Rat
2306787	Ean3	Experimental allergic neuritis QTL 3	3.1		nervous system integrity trait (VT:0010566)	body weight loss (CMO:0001399)	10	53797385	66979128	Rat
1549831	Bss6	Bone structure and strength QTL 6	4		lumbar vertebra strength trait (VT:0010574)	vertebra ultimate force (CMO:0001678)	10	57576521	102576521	Rat
61354	Pia10	Pristane induced arthritis QTL 10		0.01	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	23444813	104060283	Rat
61387	Bp1	Blood pressure QTL 1	5.1		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	51770177	107211142	Rat
61387	Bp1	Blood pressure QTL 1	5.1		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	10	51770177	107211142	Rat
61402	Niddm3	Non-insulin dependent diabetes mellitus QTL 3	4.58		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	10	61345413	82564856	Rat
61427	Cia16	Collagen induced arthritis QTL 16	3.2		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	6357896	96121100	Rat
6893336	Cm75	Cardiac mass QTL 75	0.1	0.87	heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	10	61345276	99703528	Rat
6893342	Cm78	Cardiac mass QTL 78	0.1	0.88	heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	10	42876766	79813922	Rat
7207811	Bmd90	Bone mineral density QTL 90	5.2		femur size trait (VT:1000369)	femoral neck cross-sectional area (CMO:0001697)	10	49444551	81709989	Rat
9589030	Epfw9	Epididymal fat weight QTL 9	19.24	0.001	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	10	44441699	89441699	Rat
7411614	Foco18	Food consumption QTL 18		0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	10	44441699	89441699	Rat
8662860	Vetf10	Vascular elastic tissue fragility QTL 10			artery integrity trait (VT:0010639)	number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)	10	6154182	73453136	Rat
8552805	Bw145	Body weight QTL 145	2.2		body mass (VT:0001259)	change in body weight to body weight ratio (CMO:0002216)	10	41944526	78307017	Rat
8694173	Bw149	Body weight QTL 149	4.38	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	10	44441699	89441699	Rat
10402859	Bp381	Blood pressure QTL 381		0.002	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	27606468	72606468	Rat

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

	alimentary part of gastrointestinal system	circulatory system	endocrine system	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	musculoskeletal system	nervous system	renal system	reproductive system	respiratory system	appendage
High
Medium			7	1	1	1					2
Low	1	7	21	12	13	12	8	10	6	18	8	9	8
Below cutoff		2	11	11		11					3

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_031952	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JACYVU010000220	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSRNOT00000053778

RefSeq Status:

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	10	64,686,252 - 64,686,351 (+)	Ensembl
Rnor_6.0 Ensembl	10	67,079,796 - 67,079,881 (+)	Ensembl

RefSeq Acc Id:

NR_031952

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2	10	64,686,255 - 64,686,340 (+)	NCBI
Rnor_6.0	10	67,079,796 - 67,079,881 (+)	NCBI
Rnor_5.0	10	64,570,072 - 64,570,157 (-)	NCBI
Celera	10	63,655,085 - 63,655,170 (+)	NCBI

Sequence:

show sequence

ACAGCAAGAAAAATGAGGGACTTTCAGGGGCAGCTGTGTTTCCTGACTCAGTCATAATGCCCCT
AAAAATCCTTATTGTTCTTGCA

hide sequence

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:2325371	AgrOrtholog
BioCyc Gene	G2FUF-23999	BioCyc
Ensembl Genes	ENSRNOG00000035655	Ensembl, ENTREZGENE
Ensembl Transcript	ENSRNOT00000053778	ENTREZGENE
miRBase	MI0001656	ENTREZGENE
NCBI Gene	100314252	ENTREZGENE
PhenoGen	Mir365b	PhenoGen
RNAcentral	URS00003E7283	RNACentral
	URS0000759F45	RNACentral
	URS000075C19B	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2016-03-22	Mir365b	microRNA 365b	Mir365	microRNA 365	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2014-08-15	Mir365	microRNA 365	Mir365	microRNA mir-365	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2010-06-02	Mir365	microRNA mir-365			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - CTD