Il2rg<sup>em1Ang</sup> (interleukin 2 receptor subunit gamma;TALEN induced mutant1, Ang) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Il2rgem1Ang (interleukin 2 receptor subunit gamma;TALEN induced mutant1, Ang) Rattus norvegicus
Analyze
Symbol: Il2rgem1Ang
Name: interleukin 2 receptor subunit gamma;TALEN induced mutant1, Ang
RGD ID: 13628731
Description: This mutant allele was created by TALEN targeting the exon2 of rat Il2rg gene. The TALEN mRNA was microinjected into SD/Crl embyo and created an 80bp deletion in the gene and caused a premature stop codon in the 3rd exon.
ASSOCIATED WITH decreased bone marrow cell number; decreased CD4-positive, alpha beta T cell number; decreased CD8-positive, alpha-beta T cell number; ASSOCIATED WITH Immune Deficiency Disease
Type: allele  of Il2rg  
Is Marker For: Strains:   SD-Il2rgem1Ang  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position: No map positions available.


Disease Annotations     Click to see Annotation Detail View

References

References - curated
# Reference Title Reference Citation
1. Generation of immunodeficient rats with Rag1 and Il2rg gene deletions and human tissue grafting models. Ménoret S, etal., Transplantation. 2018 Apr 24. doi: 10.1097/TP.0000000000002251.

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Il2rgem1Ang-var1 chrX 66398441 66398520 AACCCACCTTCTCTTCTTCCTGTACTACCCCTCCCCCTTCTCATACCTATAGTGCATAGTGAGGTTGGTCGGCTGAGGCT - deletion mRatBN7.2
Il2rgem1Ang-var1 chrX 71168483 71168562 AACCCACCTTCTCTTCTTCCTGTACTACCCCTCCCCCTTCTCATACCTATAGTGCATAGTGAGGTTGGTCGGCTGAGGCT - deletion Rnor_6.0

Related Rat Strains
The following Strains have been annotated to Il2rgem1Ang


Expression


Sequence

Nucleotide Sequences


Additional Information