Il2rg<sup>em1Ang</sup> (interleukin 2 receptor subunit gamma;TALEN induced mutant1, Ang) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Il2rgem1Ang (interleukin 2 receptor subunit gamma;TALEN induced mutant1, Ang) Rattus norvegicus
Analyze
Symbol: Il2rgem1Ang
Name: interleukin 2 receptor subunit gamma;TALEN induced mutant1, Ang
RGD ID: 13628731
Description: This mutant allele was created by TALEN targeting the exon2 of rat Il2rg gene. The TALEN mRNA was microinjected into SD/Crl embyo and created an 80bp deletion in the gene and caused a premature stop codon in the 3rd exon.
ASSOCIATED WITH decreased bone marrow cell number; decreased CD4-positive, alpha beta T cell number; decreased CD8-positive, alpha-beta T cell number; ASSOCIATED WITH Immune Deficiency Disease
Type: allele  of Il2rg  
Is Marker For: Strains:   SD-Il2rgem1Ang  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position: No map positions available.


Disease Annotations     Click to see Annotation Detail View

References

References - curated
# Reference Title Reference Citation
1. Generation of immunodeficient rats with Rag1 and Il2rg gene deletions and human tissue grafting models. Ménoret S, etal., Transplantation. 2018 Apr 24. doi: 10.1097/TP.0000000000002251.

Genomics


Related Rat Strains
The following Strains have been annotated to Il2rgem1Ang


Expression


Sequence

Nucleotide Sequences

Rat Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type
Il2rgem1Ang-var1 chrX 66398441 66398520 AACCCACCTTCTCTTCTTCCTGTACTACCCCTCCCCCTTCTCATACCTATAGTGCATAGTGAGGTTGGTCGGCTGAGGCT - deletion
Il2rgem1Ang-var1 chrX 71168483 71168562 AACCCACCTTCTCTTCTTCCTGTACTACCCCTCCCCCTTCTCATACCTATAGTGCATAGTGAGGTTGGTCGGCTGAGGCT - deletion

Additional Information