IL1RN (interleukin 1 receptor antagonist) - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)
Gene: IL1RN (interleukin 1 receptor antagonist) Homo sapiens
Analyze
Symbol: IL1RN
Name: interleukin 1 receptor antagonist
RGD ID: 1344540
HGNC Page HGNC:6000
Description: Enables cytokine receptor binding activity. Involved in several processes, including acute-phase response; negative regulation of heterotypic cell-cell adhesion; and negative regulation of interleukin-1-mediated signaling pathway. Located in several cellular components, including centrosome; extracellular space; and nucleoplasm. Implicated in several diseases, including autoimmune disease (multiple); eye disease (multiple); kidney failure (multiple); lung disease (multiple); and vascular disease (multiple). Biomarker of several diseases, including autoimmune disease (multiple); chronic kidney disease (multiple); glomerulonephritis (multiple); lung disease (multiple); and obesity (multiple).
Type: protein-coding
RefSeq Status: REVIEWED
Previously known as: CRMO2; DIRA; ICIL-1RA; IL-1ra; IL-1ra3; IL-1RN; IL1 inhibitor; IL1F3; IL1RA; IL1RN (IL1F3); interleukin-1 receptor antagonist protein; intracellular IL-1 receptor antagonist type II; intracellular interleukin-1 receptor antagonist (icIL-1ra); IRAP; MGC10430; MVCD4; type II interleukin-1 receptor antagonist
RGD Orthologs
Mouse
Rat
Chinchilla
Bonobo
Dog
Squirrel
Pig
Green Monkey
Naked Mole-Rat
Alliance Orthologs
More Info more info ...
Allele / Splice: See ClinVar data
Latest Assembly: GRCh38 - Human Genome Assembly GRCh38
NCBI Annotation Information: Note: This gene has been reviewed for its involvement in coronavirus biology, and is involved in immune response or antiviral activity.
Position:
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh382113,099,360 - 113,134,014 (+)NCBIGRCh38GRCh38hg38GRCh38
GRCh38.p14 Ensembl2113,099,315 - 113,134,016 (+)EnsemblGRCh38hg38GRCh38
GRCh372113,875,548 - 113,891,591 (+)NCBIGRCh37GRCh37hg19GRCh37
Build 362113,591,941 - 113,608,064 (+)NCBINCBI36Build 36hg18NCBI36
Build 342113,591,700 - 113,607,823NCBI
Celera2107,260,159 - 107,276,191 (+)NCBICelera
Cytogenetic Map2q14.1NCBI
HuRef2106,329,950 - 106,345,897 (+)NCBIHuRef
CHM1_12113,879,899 - 113,896,017 (+)NCBICHM1_1
T2T-CHM13v2.02113,544,556 - 113,560,594 (+)NCBIT2T-CHM13v2.0
JBrowse: View Region in Genome Browser (JBrowse)
Model


Disease Annotations     Click to see Annotation Detail View
Abscess  (IDA)
acute kidney failure  (IDA,ISO)
Acute Liver Failure  (EXP,IMP)
Acute Lung Injury  (ISO)
acute necrotizing pancreatitis  (IDA)
adult respiratory distress syndrome  (IEP,ISO)
alcohol dependence  (IEP)
allergic conjunctivitis  (IDA)
alopecia areata  (IAGP)
Anorexia  (EXP,ISO)
anterior uveitis  (IMP)
anthracosis  (EXP)
anti-basement membrane glomerulonephritis  (ISO)
Arsenic Poisoning  (EXP)
asthma  (EXP,IAGP,IEP,IMP)
Atrophy  (EXP)
autistic disorder  (EXP)
autoimmune thrombocytopenic purpura  (IAGP)
autosomal dominant polycystic kidney disease  (IEP)
B-Cell Chronic Lymphocytic Leukemia  (IEP)
bacterial pneumonia  (ISO)
Behcet's disease  (IEP)
Brain Injuries  (EXP)
brain ischemia  (EXP)
Bronchial Hyperreactivity  (EXP,IDA)
bronchiolitis  (IEP)
bronchiolitis obliterans  (IEP)
bronchopulmonary dysplasia  (IAGP,IEP)
bronchus carcinoma  (IEP)
Cachexia  (ISO)
calcium oxalate nephrolithiasis  (IAGP)
cardiovascular system disease  (EXP)
Carotid Artery Injuries  (IMP)
Cerebral Hemorrhage  (IMP,ISO)
cerebrovascular disease  (EXP)
Chediak-Higashi syndrome  (IAGP)
Chronic Anterior Uveitis  (IAGP)
chronic kidney disease  (IAGP,IEP)
chronic myeloid leukemia  (IEP)
chronic obstructive pulmonary disease  (IAGP,IEP)
Chronic recurrent multifocal osteomyelitis 2, with periostitis and pustulosis  (IAGP)
Chronic Rhinosinusitis  (IAGP)
Chronic Uveitis  (IEP)
cicatricial pemphigoid  (IEP)
Colonic Neoplasms  (EXP)
common cold  (IDA,IEP)
Corneal Graft Rejection  (IMP)
corneal neovascularization  (IDA,ISO)
COVID-19  (HEP)
crescentic glomerulonephritis  (IDA)
Cryopyrin-Associated Periodic Syndromes  (IDA)
cystic fibrosis  (IEP)
dacryocystitis  (IDA)
depressive disorder  (IDA)
diabetic angiopathy  (IAGP)
Diabetic Nephropathies  (IAGP)
diarrhea  (EXP)
Drug Hypersensitivity Syndrome  (IAGP)
Drug-Induced Agranulocytosis  (IEP)
Drug-Related Side Effects and Adverse Reactions  (EXP)
dry eye syndrome  (IEP)
encephalitis  (ISO)
end stage renal disease  (IAGP,IEP)
endometriosis  (IAGP)
Endotoxemia  (IDA,ISO)
Endotoxin-Induced Uveitis  (ISO)
exanthem  (EXP)
Experimental Arthritis  (IDA,IMP,ISO)
Experimental Autoimmune Encephalomyelitis  (IDA)
Experimental Autoimmune Myocarditis  (ISO)
Experimental Autoimmune Uveitis  (IDA)
Experimental Colitis  (IDA)
Experimental Diabetes Mellitus  (IMP,ISO)
Experimental Mammary Neoplasms  (IDA)
Extravasation of Diagnostic and Therapeutic Materials  (EXP)
Eye Manifestations  (IEP)
Febrile Seizures  (IDA)
Fever  (EXP,ISO)
fibromyalgia  (IEP)
Fibrosis  (EXP)
genetic disease  (IAGP)
glomerulonephritis  (IDA,ISO)
gout  (EXP)
graft-versus-host disease  (IDA)
Graves ophthalmopathy  (IAGP,IEP)
hairy cell leukemia  (IEP)
hemolytic-uremic syndrome  (IDA,IEP)
hepatocellular carcinoma  (EXP)
herpes simplex virus keratitis  (IDA)
Human Influenza  (IDA,IEP)
Hyperalgesia  (EXP,IDA,ISO)
hyperglycemia  (IEP)
hypertension  (IAGP,ISO)
IgA glomerulonephritis  (IAGP,IDA,IEP,ISO)
IgA vasculitis  (IAGP)
Inflammation  (EXP,ISO)
inflammatory bowel disease  (IMP)
interstitial lung disease  (IEP)
interstitial lung disease 2  (IAGP)
juvenile rheumatoid arthritis  (EXP)
keratoconus  (IAGP)
kidney disease  (EXP)
Kidney Reperfusion Injury  (IDA,ISO)
learning disability  (EXP,IDA)
Leukocytosis  (IDA)
Lichen Sclerosus et Atrophicus  (IAGP)
listeriosis  (IDA)
Liver Reperfusion Injury  (IDA,ISO)
lung non-small cell carcinoma  (IAGP)
lupus nephritis  (IEP)
Meibomian Gland Dysfunction  (IEP)
melanoma  (IDA)
metabolic dysfunction-associated steatotic liver disease  (EXP,IEP)
middle cerebral artery infarction  (IMP)
morbid obesity  (IEP)
Muckle-Wells syndrome  (IDA)
mucositis  (EXP)
multiple myeloma  (IAGP)
Multiple Organ Failure  (IDA,IEP)
multiple sclerosis  (EXP)
myocardial infarction  (EXP)
Myocardial Reperfusion Injury  (IDA)
myositis  (EXP,IEP)
Necrosis  (EXP)
Neoplasm Invasiveness  (EXP)
nephrotic syndrome  (IAGP)
nicotine dependence  (IDA)
obesity  (IEP,ISO)
Oligoanuria  (IEP)
osteoporosis  (IDA)
Pain  (EXP)
periodontitis  (IAGP,IEP)
pleural disease  (IEP)
pleural tuberculosis  (IAGP)
pleurisy  (IDA)
pneumonia  (HEP,IAGP,IDA,ISO)
Postoperative Cognitive Dysfunction  (IDA)
pre-eclampsia  (IEP)
Proctocolitis  (IEP)
Prostatic Neoplasms  (EXP)
prostatitis  (ISO)
proteinuria  (EXP,IAGP)
Pseudomonas Aeruginosa Keratitis  (ISO)
Pseudomonas Infections  (IEP)
pulmonary eosinophilia  (IEP)
pulmonary fibrosis  (EXP,IAGP,IEP)
pulmonary hypertension  (IDA)
pulmonary sarcoidosis  (IEP)
pulmonary tuberculosis  (IDA,IEP)
pustular psoriasis 14  (IAGP)
pyelonephritis  (IEP)
renal cell carcinoma  (IDA)
respiratory allergy  (ISO)
rheumatoid arthritis  (EXP,IDA,ISO)
rhinitis  (IAGP,IEP)
Schnitzler syndrome  (EXP,IDA)
sciatic neuropathy  (IDA)
Sclerosis  (EXP)
Sepsis  (IAGP,IDA,IEP,ISO)
Serositis  (IAGP)
silicosis  (IAGP,ISO)
Sjogren's syndrome  (IAGP,IEP)
skin disease  (EXP)
Spinal Cord Injuries  (IEP,ISO)
status epilepticus  (EXP)
stomach cancer  (IAGP)
Stomach Neoplasms  (EXP)
Stroke  (EXP,IDA)
Subarachnoid Hemorrhage  (IDA)
systemic lupus erythematosus  (IAGP,IEP)
toxic shock syndrome  (IAGP,IMP)
transient cerebral ischemia  (IDA,ISO)
Transplant Rejection  (IDA)
type 1 diabetes mellitus  (IDA,IEP)
type 2 diabetes mellitus  (IAGP)
ulcerative colitis  (IAGP)
ureteral obstruction  (IDA,ISO)
urinary bladder cancer  (IAGP)
Urinary Calculi  (IAGP)
vascular disease  (IDA)
Venous Thrombosis  (IAGP)
Ventilator-Induced Lung Injury  (ISO)
Viral Bronchiolitis  (IAGP)
viral pneumonia  (HEP)

Gene-Chemical Interaction Annotations     Click to see Annotation Detail View
(1->4)-beta-D-glucan  (ISO)
(S)-nicotine  (ISO)
1,1-dichloroethene  (ISO)
1,2-dimethylhydrazine  (ISO)
15-deoxy-Delta(12,14)-prostaglandin J2  (ISO)
17alpha-ethynylestradiol  (ISO)
17beta-estradiol  (EXP,ISO)
17beta-estradiol 3-benzoate  (ISO)
2,2',4,4',5,5'-hexachlorobiphenyl  (EXP)
2,2',5,5'-tetrachlorobiphenyl  (EXP)
2,3,7,8-tetrachlorodibenzodioxine  (EXP,ISO)
2,4,6-trinitrobenzenesulfonic acid  (ISO)
2,4-dibromophenyl 2,4,5-tribromophenyl ether  (ISO)
2,6-dimethoxyphenol  (EXP)
3',5'-cyclic AMP  (ISO)
3,3',4,4',5-pentachlorobiphenyl  (EXP)
3,3',5,5'-tetrabromobisphenol A  (EXP)
3,4-dichloroaniline  (EXP)
3,5-diethoxycarbonyl-1,4-dihydrocollidine  (ISO)
3,7-dihydropurine-6-thione  (ISO)
4,4'-sulfonyldiphenol  (ISO)
4-hydroxynon-2-enal  (ISO)
4-hydroxyphenyl retinamide  (ISO)
5-fluorouracil  (ISO)
6alpha-methylprednisolone  (EXP)
7,12-dimethyltetraphene  (ISO)
7,9-dihydro-1H-purine-2,6,8(3H)-trione  (EXP)
7-ketocholesterol  (EXP)
acetamide  (ISO)
acetylcholine  (EXP)
acetylsalicylic acid  (EXP)
aflatoxin B1  (EXP,ISO)
Aflatoxin B2 alpha  (EXP)
aldehydo-D-glucose  (ISO)
alendronic acid  (ISO)
all-trans-retinoic acid  (EXP)
all-trans-retinyl palmitate  (EXP)
alpha-naphthoflavone  (EXP)
alpha-Zearalanol  (ISO)
aluminium hydroxide  (EXP)
ammonium chloride  (ISO)
antimonite  (EXP)
antirheumatic drug  (EXP)
arsane  (EXP,ISO)
arsenic atom  (EXP,ISO)
arsenite(3-)  (EXP)
arsenous acid  (EXP)
astressin  (ISO)
azathioprine  (EXP)
Azoxymethane  (ISO)
beclomethasone  (EXP)
benzene  (EXP)
benzo[a]pyrene  (EXP,ISO)
beta-endorphin  (ISO)
beta-naphthoflavone  (EXP)
bis(2-chloroethyl) sulfide  (EXP,ISO)
bisphenol A  (EXP,ISO)
cadmium atom  (EXP)
cadmium dichloride  (ISO)
calcitriol  (EXP)
capsaicin  (ISO)
carbon nanotube  (ISO)
carvedilol  (ISO)
celastrol  (EXP)
ceric oxide  (ISO)
cholesterol  (EXP)
choline  (ISO)
cisplatin  (ISO)
cobalt dichloride  (EXP)
copper(II) sulfate  (EXP)
corn oil  (ISO)
crocidolite asbestos  (EXP)
cyclophosphamide  (ISO)
cyclosporin A  (EXP,ISO)
D-glucose  (ISO)
delta-tocotrienol  (ISO)
deoxynivalenol  (ISO)
dexamethasone  (EXP,ISO)
dextran sulfate  (ISO)
diallyl disulfide  (EXP)
Diallyl sulfide  (EXP)
diarsenic trioxide  (EXP)
Dibutyl phosphate  (EXP)
dichloroacetic acid  (ISO)
dichloromethane  (ISO)
diclofenac  (EXP,ISO)
dicrotophos  (EXP)
dioxygen  (EXP,ISO)
dipotassium bis[mu-tartrato(4-)]diantimonate(2-) trihydrate  (EXP)
diuron  (EXP)
doxorubicin  (ISO)
elemental selenium  (EXP)
endosulfan  (ISO)
epoxiconazole  (ISO)
erlotinib hydrochloride  (EXP)
ethanol  (ISO)
Evodiamine  (ISO)
folic acid  (ISO)
fructose  (ISO)
fumonisin B1  (ISO)
furfural  (EXP)
gedunin  (EXP)
Genipin  (ISO)
genistein  (ISO)
gentamycin  (ISO)
glafenine  (ISO)
glucose  (ISO)
glycidol  (ISO)
graphene oxide  (ISO)
graphite  (ISO)
hydroquinone  (EXP)
ibuprofen  (EXP,ISO)
indometacin  (EXP)
ionomycin  (EXP)
iron(2+) sulfate (anhydrous)  (EXP)
isoliquiritigenin  (ISO)
isoprenaline  (EXP)
ivermectin  (EXP)
L-methionine  (ISO)
lead diacetate  (ISO)
leflunomide  (EXP)
lenalidomide  (ISO)
lipopolysaccharide  (EXP,ISO)
malonaldehyde  (EXP)
manganese(II) chloride  (ISO)
mercaptopurine  (ISO)
mercury dichloride  (EXP)
metformin  (ISO)
methacholine chloride  (EXP,ISO)
methapyrilene  (ISO)
methotrexate  (EXP)
methylmercury chloride  (ISO)
methyltestosterone  (EXP)
microcystin-LR  (ISO)
Mofezolac (TN)  (EXP)
morphine  (EXP)
N-methyl-4-phenylpyridinium  (ISO)
N-nitrosodiethylamine  (ISO)
nickel atom  (EXP)
nickel sulfate  (EXP,ISO)
nicotine  (ISO)
okadaic acid  (EXP)
oxaliplatin  (ISO)
ozone  (EXP,ISO)
p-chloromercuribenzoic acid  (EXP)
paracetamol  (EXP,ISO)
paraquat  (EXP,ISO)
paricalcitol  (EXP)
pentane-2,3-dione  (ISO)
perfluorooctane-1-sulfonic acid  (ISO)
perfluorooctanoic acid  (ISO)
phloretin  (EXP)
phorbol 13-acetate 12-myristate  (EXP)
phosphorus atom  (EXP)
phosphorus(.)  (EXP)
pirinixic acid  (EXP,ISO)
piroxicam  (EXP)
poly(I:C)  (EXP)
potassium dichromate  (ISO)
prednisolone  (EXP)
pregnenolone 16alpha-carbonitrile  (ISO)
progesterone  (ISO)
prostaglandin E2  (EXP)
purine-6-thiol  (ISO)
quercetin  (ISO)
resveratrol  (EXP,ISO)
rofecoxib  (EXP)
rotenone  (ISO)
scopolamine  (ISO)
selenium atom  (EXP)
serpentine asbestos  (EXP)
silicon dioxide  (EXP,ISO)
silver atom  (EXP)
silver(0)  (EXP)
sodium arsenite  (EXP,ISO)
sodium aurothiomalate  (EXP)
sodium chloride  (EXP)
sodium fluoride  (ISO)
Soman  (ISO)
streptozocin  (ISO)
succimer  (ISO)
sulfasalazine  (ISO)
tacrolimus hydrate  (ISO)
testosterone  (ISO)
tetrachloroethene  (ISO)
tetrachloromethane  (ISO)
thalidomide  (ISO)
thioacetamide  (ISO)
titanium dioxide  (EXP,ISO)
topotecan  (ISO)
tremolite asbestos  (ISO)
trichloroethene  (ISO)
trimellitic anhydride  (ISO)
trimethyltin  (ISO)
triphenyl phosphate  (EXP)
urethane  (EXP)
wortmannin  (ISO)
zearalenone  (EXP)
zinc atom  (EXP)
zinc dichloride  (EXP)
zinc oxide  (ISO)
zinc(0)  (EXP)

Gene Ontology Annotations     Click to see Annotation Detail View

Cellular Component

Molecular Pathway Annotations     Click to see Annotation Detail View
Phenotype Annotations     Click to see Annotation Detail View

Human Phenotype
Abnormal bladder morphology  (IAGP)
Abnormal renal morphology  (IAGP)
Abnormality of the immune system  (IAGP)
Abnormality of the skin  (IAGP)
Abnormality of the urinary system  (IAGP)
Abnormality of urine homeostasis  (IAGP)
Abscess  (IAGP)
Acquired abnormal hair pattern  (IAGP)
Albuminuria  (IAGP)
Alopecia universalis  (IAGP)
Antinuclear antibody positivity  (IAGP)
Arthralgia  (IAGP)
Arthritis  (IAGP)
Autosomal recessive inheritance  (IAGP)
Broad ribs  (IAGP)
Decreased glomerular filtration rate  (IAGP)
Elevated circulating C-reactive protein concentration  (IAGP)
Elevated circulating creatinine concentration  (IAGP)
Elevated erythrocyte sedimentation rate  (IAGP)
Endometriosis  (IAGP)
Epidermal acanthosis  (IAGP)
Failure to thrive in infancy  (IAGP)
Fetal distress  (IAGP)
Flaring of rib cage  (IAGP)
Fused cervical vertebrae  (IAGP)
Generalized edema  (IAGP)
Heavy proteinuria  (IAGP)
Hematuria  (IAGP)
Hepatomegaly  (IAGP)
Hypercholesterolemia  (IAGP)
Hyperglycemia  (IAGP)
Hyperkeratosis  (IAGP)
Hypoalbuminemia  (IAGP)
Increased inflammatory response  (IAGP)
Increased level of L-fucose in urine  (IAGP)
Inflammation of the large intestine  (IAGP)
Joint swelling  (IAGP)
Motor delay  (IAGP)
Multiple myeloma  (IAGP)
Neonatal onset  (IAGP)
Neutrophilia  (IAGP)
Osteolysis  (IAGP)
Osteomyelitis  (IAGP)
Osteopenia  (IAGP)
Periodontitis  (IAGP)
Periostitis  (IAGP)
Proteinuria  (IAGP)
Pulmonary fibrosis  (IAGP)
Pustule  (IAGP)
Respiratory distress  (IAGP)
Skin rash  (IAGP)
Small for gestational age  (IAGP)
Splenomegaly  (IAGP)
Stomach cancer  (IAGP)
Stomatitis  (IAGP)
Typified by somatic mosaicism  (IAGP)
References

References - curated
# Reference Title Reference Citation
1. Serum interleukin 1 receptor antagonist as an independent marker of non-alcoholic steatohepatitis in humans. null
2. Association of interleukin-1A, interleukin-1B and interleukin-1 receptor antagonist gene polymorphisms with multiple myeloma. Abazis-Stamboulieh D, etal., Leuk Lymphoma. 2007 Nov;48(11):2196-203.
3. Association of low-grade inflammation with nephropathy in type 2 diabetic patients: role of elevated CRP-levels and 2 different gene-polymorphisms of proinflammatory cytokines. Abrahamian H, etal., Exp Clin Endocrinol Diabetes. 2007 Jan;115(1):38-41.
4. Genetic association of interleukin-1beta (-511C/T) and interleukin-1 receptor antagonist (86 bp repeat) polymorphisms with Type 2 diabetes mellitus in North Indians. Achyut BR, etal., Clin Chim Acta. 2007 Feb;377(1-2):163-9. Epub 2006 Oct 27.
5. Cytokine gene polymorphisms are associated with risk of urinary bladder cancer and recurrence after BCG immunotherapy. Ahirwar DK, etal., Biomarkers. 2009 Jun;14(4):213-8.
6. ANG II receptor blockade enhances anti-inflammatory macrophages in anti-glomerular basement membrane glomerulonephritis. Aki K, etal., Am J Physiol Renal Physiol. 2010 Apr;298(4):F870-82. Epub 2010 Jan 13.
7. Chronic inhibition of endoplasmic reticulum stress and inflammation prevents ischaemia-induced vascular pathology in type II diabetic mice. Amin A, etal., J Pathol. 2012 Jun;227(2):165-74. doi: 10.1002/path.3960. Epub 2012 Feb 17.
8. Interleukin 1 receptor antagonist gene polymorphism is associated with severe renal involvement and renal sequelae in Henoch-Schonlein purpura. Amoli MM, etal., J Rheumatol. 2002 Jul;29(7):1404-7.
9. Recombinant human interleukin-1 receptor antagonist in the treatment of steroid-resistant graft-versus-host disease. Antin JH, etal., Blood. 1994 Aug 15;84(4):1342-8.
10. Interleukin-1 receptor antagonist gene polymorphism and mortality in patients with severe sepsis. Arnalich F, etal., Clin Exp Immunol. 2002 Feb;127(2):331-6.
11. Cytokine mRNA in the joints and draining lymph nodes of rats with adjuvant arthritis and effects of cyclosporin A. Ayer LM, etal., Inflammation. 2000 Oct;24(5):447-61.
12. Regulation of proinflammatory cytokines in seasonal allergic rhinitis. Bachert C, etal., Int Arch Allergy Immunol. 1999 Feb-Apr;118(2-4):375-9.
13. Multiplex immunoassay analysis of cytokines in idiopathic inflammatory myopathy. Baird GS and Montine TJ, Arch Pathol Lab Med. 2008 Feb;132(2):232-8. doi: 10.1043/1543-2165(2008)132[232:MIAOCI]2.0.CO;2.
14. Correlation of serum levels of interleukin-1 family members with disease activity and response to treatment in hairy cell leukemia. Barak V, etal., Eur Cytokine Netw. 1998 Mar;9(1):33-9.
15. Comparison of cytokine gene polymorphism in drug-induced maculopapular eruption, urticaria and drug reaction with eosinophilia and systemic symptoms (DRESS). Barbaud A, etal., J Eur Acad Dermatol Venereol. 2014 Apr;28(4):491-9. doi: 10.1111/jdv.12130. Epub 2013 Mar 6.
16. Intracisternal interleukin-1 receptor antagonist prevents postoperative cognitive decline and neuroinflammatory response in aged rats. Barrientos RM, etal., J Neurosci. 2012 Oct 17;32(42):14641-8. doi: 10.1523/JNEUROSCI.2173-12.2012.
17. Soluble interleukin-1 receptor antagonist concentration in patients with Graves' ophthalmopathy is neither related to cigarette smoking nor predictive of subsequent response to glucocorticoids. Bartalena L, etal., Clin Endocrinol (Oxf). 2000 May;52(5):647-51.
18. Interleukin-1 receptor antagonist as a biomarker for bronchiolitis obliterans syndrome in lung transplant recipients. Belperio JA, etal., Transplantation. 2002 Feb 27;73(4):591-9.
19. Blood serum interleukin-1 receptor antagonist in pars planitis and ocular Behcet disease. Benezra D, etal., Am J Ophthalmol. 1997 May;123(5):593-8.
20. Nucleotide variation, haplotype structure, and association with end-stage renal disease of the human interleukin-1 gene cluster. Bensen JT, etal., Genomics. 2003 Aug;82(2):194-217.
21. Altered levels of the soluble IL-1, IL-4 and TNF receptors, as well as the IL-1 receptor antagonist, in intermittent allergic rhinitis. Benson M, etal., Int Arch Allergy Immunol. 2004 Jul;134(3):227-32. Epub 2004 Jun 1.
22. Host adaptive immunity deficiency in severe pandemic influenza. Bermejo-Martin JF, etal., Crit Care. 2010 Sep 14;14(5):R167.
23. Attenuation of stroke size in rats using an adenoviral vector to induce overexpression of interleukin-1 receptor antagonist in brain. Betz AL, etal., J Cereb Blood Flow Metab. 1995 Jul;15(4):547-51.
24. Association of interleukin-1Ra gene polymorphism in patients with bladder cancer: case control study from North India. Bid HK, etal., Urology. 2006 May;67(5):1099-104.
25. Counteracting corneal immunoinflammatory lesion with interleukin-1 receptor antagonist protein. Biswas PS, etal., J Leukoc Biol. 2004 Oct;76(4):868-75. Epub 2004 Jul 16.
26. Interleukin-1 receptor antagonist allele (IL1RN*2) associated with nephropathy in diabetes mellitus. Blakemore AI, etal., Hum Genet. 1996 Mar;97(3):369-74.
27. Targeted systemic radiotherapy with scVEGF/177Lu leads to sustained disruption of the tumor vasculature and intratumoral apoptosis. Blankenberg FG, etal., J Nucl Med. 2011 Oct;52(10):1630-7. Epub 2011 Sep 2.
28. Acute bacterial inflammation of the mouse prostate. Boehm BJ, etal., Prostate. 2012 Feb;72(3):307-17. doi: 10.1002/pros.21433. Epub 2011 Jun 16.
29. Analysis of IL1 gene polymorphisms and transcript levels in periodontal and chronic kidney disease. Braosi AP, etal., Cytokine. 2012 Oct;60(1):76-82. Epub 2012 Jul 13.
30. Measurement of interleukin-1 receptor antagonist in patients with systemic lupus erythematosus could predict renal manifestation of the disease. Brugos B, etal., Hum Immunol. 2010 Sep;71(9):874-7. Epub 2010 Jun 9.
31. Interleukin 1 receptor antagonist (IL1RA) in acute leukaemia: IL1RA is both secreted spontaneously by myelogenous leukaemia blasts and is a part of the acute phase reaction in patients with chemotherapy-induced leucopenia. Bruserud O, etal., Eur J Haematol. 1996 Jul;57(1):87-95.
32. Evaluation of five interleukin genes for association with end-stage renal disease in white Europeans. Buckham TA, etal., Am J Nephrol. 2010;32(2):103-8. Epub 2010 Jun 16.
33. Interleukin-1 receptor antagonist gene polymorphism affects the progression of chronic renal failure. Buraczynska M, etal., Cytokine. 2006 Nov;36(3-4):167-72. Epub 2007 Jan 16.
34. Association between bronchopulmonary dysplasia and MBL2 and IL1-RN polymorphisms. Cakmak BC, etal., Pediatr Int. 2012 Dec;54(6):863-8. doi: 10.1111/j.1442-200X.2012.03714.x. Epub 2012 Nov 21.
35. Trigeminal-Rostral Ventromedial Medulla circuitry is involved in orofacial hyperalgesia contralateral to tissue injury. Chai B, etal., Mol Pain. 2012 Oct 23;8:78. doi: 10.1186/1744-8069-8-78.
36. Delivery of biologically active anti-inflammatory cytokines IL-10 and IL-1ra in vivo by the Shigella type III secretion apparatus. Chamekh M, etal., J Immunol. 2008 Mar 15;180(6):4292-8.
37. Dual biological functions of an interleukin-1 receptor antagonist-interleukin-10 fusion protein and its suppressive effects on joint inflammation. Chang DM, etal., Immunology. 2004 Aug;112(4):643-50.
38. Interleukin-1 receptor antagonist modulates the progression of a spontaneously occurring IgA nephropathy in mice. Chen A, etal., Am J Kidney Dis. 1997 Nov;30(5):693-702.
39. Increased prevalence of interleukin-1 receptor antagonist gene polymorphism in patients with chronic rhinosinusitis. Cheng YK, etal., Arch Otolaryngol Head Neck Surg. 2006 Mar;132(3):285-90.
40. Interleukin 1 receptor antagonist gene polymorphism association with lichen sclerosus. Clay FE, etal., Hum Genet. 1994 Oct;94(4):407-10.
41. Evaluation of interleukin-1 receptor antagonist (IL-1RA) and tumor necrosis factor binding protein (TNF-BP) in a rodent abscess model of host resistance. Colagiovanni DB and Shopp GM, Immunopharmacol Immunotoxicol. 1996 Aug;18(3):397-419.
42. Distinct cytokine production by lung and blood neutrophils from children with cystic fibrosis. Corvol H, etal., Am J Physiol Lung Cell Mol Physiol. 2003 Jun;284(6):L997-1003. Epub 2003 Jan 24.
43. Cytokine-mediated inflammatory hyperalgesia limited by interleukin-1 receptor antagonist. Cunha JM, etal., Br J Pharmacol. 2000 Jul;130(6):1418-24.
44. Topical interleukin 1 receptor antagonist promotes corneal transplant survival. Dana MR, etal., Transplantation. 1997 May 27;63(10):1501-7.
45. Clinical correlates of elevated serum concentrations of cytokines and autoantibodies in patients with spinal cord injury. Davies AL, etal., Arch Phys Med Rehabil. 2007 Nov;88(11):1384-93.
46. Beneficial response to anakinra and thalidomide in Schnitzler's syndrome. de Koning HD, etal., Ann Rheum Dis. 2006 Apr;65(4):542-4. Epub 2005 Aug 11.
47. Expression of multiple cytokines and IL-1RA in the uvea and retina during endotoxin-induced uveitis in the rat. de Vos AF, etal., Invest Ophthalmol Vis Sci. 1994 Oct;35(11):3873-83.
48. [Role of interleukin-1 receptor antagonist in protecting kidney from injury induced by asphyxia in neonatal rats]. Dong WB, etal., Zhongguo Wei Zhong Bing Ji Jiu Yi Xue. 2005 Oct;17(10):623-5.
49. The association between mortality rates and decreased concentrations of interleukin-10 and interleukin-1 receptor antagonist in the lung fluids of patients with the adult respiratory distress syndrome. Donnelly SC, etal., Ann Intern Med. 1996 Aug 1;125(3):191-6.
50. Neutrophil apoptosis, activation and anti-inflammatory cytokine response in granulocyte colony-stimulating factor-treated patients with community-acquired pneumonia. Droemann D, etal., Respiration. 2006;73(3):340-6. Epub 2005 Dec 12.
51. Cytokine inhibitors: soluble tumor necrosis factor receptor 1 and interleukin-1 receptor antagonist in Behcet's disease. Duzgun N, etal., Rheumatol Int. 2005 Jan;25(1):1-5. Epub 2003 Nov 5.
52. The role of interleukin-1ss in arthritic pain: Main involvement in thermal but not in mechanical hyperalgesia in rat antigen-induced arthritis. Ebbinghaus M, etal., Arthritis Rheum. 2012 Aug 29. doi: 10.1002/art.34675.
53. Correlation of metalloproteinase-2 and -9 with proinflammatory cytokines interleukin-1b, interleukin-12 and the interleukin-1 receptor antagonist in patients with chronic uveitis. El-Shabrawi YG, etal., Curr Eye Res. 2000 Mar;20(3):211-4.
54. Tear cytokine and chemokine analysis and clinical correlations in evaporative-type dry eye disease. Enriquez-de-Salamanca A, etal., Mol Vis. 2010 May 19;16:862-73.
55. Interleukin-1 mediates endothelin-1-induced fever and prostaglandin production in the preoptic area of rats. Fabricio AS, etal., Am J Physiol Regul Integr Comp Physiol. 2006 Jun;290(6):R1515-23. Epub 2006 Feb 2.
56. Effects of aging and cytokine blockade on inflammatory cachexia. Fathalla B, etal., Clin Exp Rheumatol. 2004 Jan-Feb;22(1):85-90.
57. Recombinant human interleukin 1 receptor antagonist in the treatment of patients with sepsis syndrome. Results from a randomized, double-blind, placebo-controlled trial. Phase III rhIL-1ra Sepsis Syndrome Study Group. Fisher CJ Jr, etal., JAMA. 1994 Jun 15;271(23):1836-43.
58. Protection from experimental ventilator-induced acute lung injury by IL-1 receptor blockade. Frank JA, etal., Thorax. 2008 Feb;63(2):147-53. Epub 2007 Sep 27.
59. Interleukin-1-dependent sequential chemokine expression and inflammatory cell infiltration in ischemia-reperfusion injury. Furuichi K, etal., Crit Care Med. 2006 Sep;34(9):2447-55.
60. Serum IL-6 and IL-1-ra with sequential organ failure assessment scores in septic patients receiving high-volume haemofiltration and continuous venovenous haemofiltration. Ghani RA, etal., Nephrology (Carlton). 2006 Oct;11(5):386-93.
61. GOAs Human GO annotations GOA_HUMAN data from the GO Consortium
62. Association of the interleukin-1 receptor antagonist gene with asthma. Gohlke H, etal., Am J Respir Crit Care Med. 2004 Jun 1;169(11):1217-23. Epub 2004 Mar 12.
63. Neonatal-onset multisystem inflammatory disease responsive to interleukin-1beta inhibition. Goldbach-Mansky R, etal., N Engl J Med. 2006 Aug 10;355(6):581-92.
64. Inflammatory cytokines in patients with persistence of the acute respiratory distress syndrome. Goodman RB, etal., Am J Respir Crit Care Med. 1996 Sep;154(3 Pt 1):602-11.
65. Lentiviral-mediated gene delivery to synovium: potent intra-articular expression with amplification by inflammation. Gouze E, etal., Mol Ther. 2003 Apr;7(4):460-6.
66. Murine monoclonal anti-tNF antibody administration has a beneficial effect on inflammatory bowel disease that develops in IL-10 knockout mice. Gratz R, etal., Dig Dis Sci. 2002 Aug;47(8):1723-7.
67. Rapid brain penetration of interleukin-1 receptor antagonist in rat cerebral ischaemia: pharmacokinetics, distribution, protection. Greenhalgh AD, etal., Br J Pharmacol. 2010 May;160(1):153-9. doi: 10.1111/j.1476-5381.2010.00684.x.
68. Interleukin-1 receptor antagonist is beneficial after subarachnoid haemorrhage in rat by blocking haem-driven inflammatory pathology. Greenhalgh AD, etal., Dis Model Mech. 2012 Nov;5(6):823-33. doi: 10.1242/dmm.008557. Epub 2012 May 31.
69. Impact of an interleukin-1 receptor antagonist and erythropoietin on experimental myocardial ischemia/reperfusion injury. Grothusen C, etal., ScientificWorldJournal. 2012;2012:737585. Epub 2012 May 2.
70. Association between Albuminuria, Kidney Function, and Inflammatory Biomarker Profile. Gupta J, etal., Clin J Am Soc Nephrol. 2012 Sep 27.
71. Interleukin-1 cluster gene polymorphisms in childhood IgA nephropathy. Hahn WH, etal., Pediatr Nephrol. 2009 Jul;24(7):1329-36. Epub 2009 Mar 12.
72. Role of IL-1 in renal ischemic reperfusion injury. Haq M, etal., J Am Soc Nephrol. 1998 Apr;9(4):614-9.
73. Transfer of the interleukin-1 receptor antagonist gene into rat liver abrogates hepatic ischemia-reperfusion injury. Harada H, etal., Transplantation. 2002 Nov 27;74(10):1434-41.
74. Substance P in polymicrobial sepsis: molecular fingerprint of lung injury in preprotachykinin-A-/- mice. Hegde A, etal., Mol Med. 2010 May-Jun;16(5-6):188-98. Epub 2010 Feb 8.
75. Causal links between brain cytokines and experimental febrile convulsions in the rat. Heida JG and Pittman QJ, Epilepsia. 2005 Dec;46(12):1906-13.
76. The influence of uremic serum on interleukin-1beta and interleukin-1 receptor antagonist production by peripheral blood mononuclear cells. Higuchi T, etal., Ther Apher Dial. 2006 Feb;10(1):65-71.
77. Functions of interleukin 1 receptor antagonist in gene knockout and overproducing mice. Hirsch E, etal., Proc Natl Acad Sci U S A. 1996 Oct 1;93(20):11008-13.
78. Development of chronic inflammatory arthropathy resembling rheumatoid arthritis in interleukin 1 receptor antagonist-deficient mice. Horai R, etal., J Exp Med. 2000 Jan 17;191(2):313-20.
79. Lack of associations between several polymorphisms in cytokine genes and the risk of chronic obstructive pulmonary diseases in Taiwan. Hsieh MH, etal., Kaohsiung J Med Sci. 2008 Mar;24(3):126-37.
80. Interleukin-1 receptor antagonist enhances islet engraftment without impacting serum levels of nitrite or osteopontin. Hsu BR, etal., Transplant Proc. 2009 Jun;41(5):1781-5.
81. Interleukin-1 beta, interleukin-1 receptor antagonist and interleukin-6 plasma levels and cytokine gene polymorphisms in chronic lymphocytic leukemia: correlation with prognostic parameters. Hulkkonen J, etal., Haematologica. 2000 Jun;85(6):600-6.
82. Effects of interleukin-1 receptor antagonist overexpression on infection by Listeria monocytogenes. Irikura VM, etal., Infect Immun. 1999 Apr;67(4):1901-9.
83. The mechanism of altered neural function in a rat model of acute colitis. Jacobson K, etal., Gastroenterology. 1997 Jan;112(1):156-62.
84. Enhanced production of IL-1 receptor antagonist by alveolar macrophages from patients with interstitial lung disease. Janson RW, etal., Am Rev Respir Dis. 1993 Aug;148(2):495-503.
85. Acute bile duct ligation ameliorates ischemic renal failure. Jeyarajah DR, etal., Nephron Physiol. 2003;95(2):p28-35.
86. Allergic rhinitis and polymorphisms of the interleukin 1 gene complex. Joki-Erkkila VP, etal., Ann Allergy Asthma Immunol. 2003 Sep;91(3):275-9.
87. Association between SLE nephritis and polymorphic variants of the CRP and FcgammaRIIIa genes. Jonsen A, etal., Rheumatology (Oxford). 2007 Sep;46(9):1417-21. Epub 2007 Jun 27.
88. Adipose tissue is a major source of interleukin-1 receptor antagonist: upregulation in obesity and inflammation. Juge-Aubry CE, etal., Diabetes. 2003 May;52(5):1104-10.
89. Significance of IL-1beta and IL-1 receptor antagonist (IL-1Ra) in bronchoalveolar lavage fluid (BALF) in patients with diffuse panbronchiolitis (DPB). Kadota J, etal., Clin Exp Immunol. 1996 Mar;103(3):461-6.
90. Contribution of IL-1 to resistance to Streptococcus pneumoniae infection. Kafka D, etal., Int Immunol. 2008 Sep;20(9):1139-46. Epub 2008 Jul 1.
91. Interleukin-1 balance in the lungs of preterm infants who develop bronchopulmonary dysplasia. Kakkera DK, etal., Biol Neonate. 2005;87(2):82-90. Epub 2004 Oct 14.
92. Prevention of allergic eye disease by treatment with IL-1 receptor antagonist. Keane-Myers AM, etal., Invest Ophthalmol Vis Sci. 1999 Nov;40(12):3041-6.
93. Early cytokine and chemokine gene expression during Pseudomonas aeruginosa corneal infection in mice. Kernacki KA, etal., Infect Immun. 1998 Jan;66(1):376-9.
94. Graves' ophthalmopathy and gene polymorphisms in interleukin-1alpha, interleukin-1beta, interleukin-1 receptor and interleukin-1 receptor antagonist. Khalilzadeh O, etal., Clin Experiment Ophthalmol. 2009 Aug;37(6):614-9. doi: 10.1111/j.1442-9071.2009.02093.x.
95. Association of IL-1beta, IL-1ra, and TNF-alpha gene polymorphisms in childhood nephrotic syndrome. Kim SD, etal., Pediatr Nephrol. 2004 Mar;19(3):295-9. Epub 2004 Feb 3.
96. Interleukin-1 receptor antagonist decreases bone loss and bone resorption in ovariectomized rats. Kimble RB, etal., J Clin Invest. 1994 May;93(5):1959-67.
97. Quantitative and qualitative urinary cellular patterns correlate with progression of murine glomerulonephritis. Kimura J, etal., PLoS One. 2011 Jan 31;6(1):e16472.
98. Perioperative immunomodulation with interleukin-2 in patients with renal cell carcinoma: results of a controlled phase II trial. Klatte T, etal., Br J Cancer. 2006 Nov 6;95(9):1167-73. Epub 2006 Oct 10.
99. Relative release of interleukin-1 beta and interleukin-1 receptor antagonist by alveolar macrophages. A study in asbestos-induced lung disease, sarcoidosis, and idiopathic pulmonary fibrosis. Kline JN, etal., Chest. 1993 Jul;104(1):47-53.
100. Serum levels of tumor necrosis factor-alpha, soluble intercellular adhesion molecule-1, soluble vascular cell adhesion molecule-1, and soluble interleukin-1 receptor antagonist in patients with thyroid eye disease undergoing treatment with somatostatin analogues. Krassas GE, etal., Thyroid. 2001 Dec;11(12):1115-22.
101. Cytokines in sputum and serum from patients with cystic fibrosis and chronic Pseudomonas aeruginosa infection as markers of destructive inflammation in the lungs. Kronborg G, etal., Pediatr Pulmonol. 1993 May;15(5):292-7.
102. NLRP3 E311K mutation in a large family with Muckle-Wells syndrome--description of a heterogeneous phenotype and response to treatment. Kuemmerle-Deschner JB, etal., Arthritis Res Ther. 2011;13(6):R196. Epub 2011 Dec 6.
103. Interleukin 1 components in cicatricial pemphigoid. Role in intravenous immunoglobulin therapy. Kumari S, etal., Cytokine. 2001 May 21;14(4):218-24.
104. Interleukin-1 receptor antagonist halts the progression of established crescentic glomerulonephritis in the rat. Lan HY, etal., Kidney Int. 1995 May;47(5):1303-9.
105. Changes of plasma interleukin-1 receptor antagonist, interleukin-8 and other serologic markers during chemotherapy in patients with active pulmonary tuberculosis. Lee JH and Chang JH, Korean J Intern Med. 2003 Sep;18(3):138-45.
106. Polymorphisms in interleukin-1B and its receptor antagonist genes and the risk of chronic obstructive pulmonary disease in a Korean population: a case-control study. Lee JM, etal., Respir Med. 2008 Sep;102(9):1311-20. Epub 2008 Jun 24.
107. Genetics of diabetic nephropathy in type 2 DM: candidate gene analysis for the pathogenic role of inflammation. Lee SH, etal., Nephrology (Carlton). 2005 Oct;10 Suppl:S32-6.
108. [Effects of interleukin-10 on expression of inflammatory mediators and anti-inflammatory mediators during acute lung injury in rats] Li HX, etal., Zhongguo Wei Zhong Bing Ji Jiu Yi Xue. 2005 Jun;17(6):338-41.
109. Suppression of immune-mediated ocular inflammation in mice by interleukin 1 receptor antagonist administration. Lim WK, etal., Arch Ophthalmol. 2005 Jul;123(7):957-63.
110. Association analysis of polymorphisms at the interleukin-1 locus in essential hypertension. Lin RC and Morris BJ, Am J Med Genet. 2002 Feb 1;107(4):311-6.
111. Interleukin 1 receptor antagonist gene polymorphism and risk of lung cancer: a possible interaction with polymorphisms in the interleukin 1 beta gene. Lind H, etal., Lung Cancer. 2005 Dec;50(3):285-90. Epub 2005 Aug 26.
112. Circulating inflammatory cytokine levels in hemolytic uremic syndrome. Litalien C, etal., Pediatr Nephrol. 1999 Nov;13(9):840-5.
113. Effect of hydrodynamics-based gene delivery of plasmid DNA encoding interleukin-1 receptor antagonist-Ig for treatment of rat autoimmune myocarditis: possible mechanism for lymphocytes and noncardiac cells. Liu H, etal., Circulation. 2005 Apr 5;111(13):1593-600. Epub 2005 Mar 28.
114. Selective delivery of interleukine-1 receptor antagonist to inflamed joint by albumin fusion. Liu M, etal., BMC Biotechnol. 2012 Sep 25;12(1):68.
115. Interleukin-1 receptor antagonist allele: is it a genetic link between Henoch-Schonlein nephritis and IgA nephropathy? Liu ZH, etal., Kidney Int. 1997 Jun;51(6):1938-42.
116. Age-Related Comparisons of Evolution of the Inflammatory Response After Intracerebral Hemorrhage in Rats. Lively S and Schlichter LC, Transl Stroke Res. 2012 Jul;3(Suppl 1):132-146. Epub 2012 Mar 16.
117. Associations between interleukin-1 (IL-1) gene variations or IL-1 receptor antagonist levels and the development of type 2 diabetes. Luotola K, etal., J Intern Med. 2011 Mar;269(3):322-32. doi: 10.1111/j.1365-2796.2010.02294.x.
118. The immune-inflammatory pathophysiology of fibromyalgia: increased serum soluble gp130, the common signal transducer protein of various neurotrophic cytokines. Maes M, etal., Psychoneuroendocrinology. 1999 May;24(4):371-83.
119. Proinflammatory cytokine gene polymorphisms among Iranian patients with asthma. Mahdaviani SA, etal., J Clin Immunol. 2009 Jan;29(1):57-62. Epub 2008 Sep 2.
120. Interleukin-1beta and receptor antagonist (IL-1Ra) gene polymorphisms and the prediction of the risk of end-stage renal disease. Manchanda PK, etal., Biomarkers. 2006 Mar-Apr;11(2):164-73.
121. Copper chelation represses the vascular response to injury. Mandinov L, etal., Proc Natl Acad Sci U S A. 2003 May 27;100(11):6700-5. Epub 2003 May 16.
122. Novel genetic association between ulcerative colitis and the anti-inflammatory cytokine interleukin-1 receptor antagonist. Mansfield JC, etal., Gastroenterology. 1994 Mar;106(3):637-42.
123. Effects of coupled plasma filtration adsorption on immune function of patients with multiple organ dysfunction syndrome. Mao HJ, etal., Int J Artif Organs. 2009 Jan;32(1):31-8.
124. Imbalance production between interleukin-1beta (IL-1beta) and IL-1 receptor antagonist (IL-1Ra) in bronchial asthma. Mao XQ, etal., Biochem Biophys Res Commun. 2000 Sep 24;276(2):607-12.
125. Protective effect of the interleukin-1 receptor antagonist (IL-1ra) on experimental allergic encephalomyelitis in rats. Martin D and Near SL, J Neuroimmunol. 1995 Sep;61(2):241-5.
126. Overexpression of interleukin-1 receptor antagonist reduces brain edema induced by intracerebral hemorrhage and thrombin. Masada T, etal., Acta Neurochir Suppl. 2003;86:463-7.
127. Circulating monocytes from systemic sclerosis patients with interstitial lung disease show an enhanced profibrotic phenotype. Mathai SK, etal., Lab Invest. 2010 Jun;90(6):812-23. Epub 2010 Apr 19.
128. IL-1 plays an important role in lipid metabolism by regulating insulin levels under physiological conditions. Matsuki T, etal., J Exp Med. 2003 Sep 15;198(6):877-88.
129. IL-1 receptor antagonist serum levels are increased in human obesity: a possible link to the resistance to leptin? Meier CA, etal., J Clin Endocrinol Metab. 2002 Mar;87(3):1184-8.
130. Cytokine gene polymorphisms involved in chronicity and complications of anterior uveitis. Menezo V, etal., Cytokine. 2006 Aug;35(3-4):200-6. Epub 2006 Sep 26.
131. Cytokine profile in autosomal dominant polycystic kidney disease. Merta M, etal., Biochem Mol Biol Int. 1997 Mar;41(3):619-24.
132. Anakinra for rheumatoid arthritis: a systematic review. Mertens M and Singh JA, J Rheumatol. 2009 Jun;36(6):1118-25. Epub 2009 May 15.
133. Effect of treatment with interleukin-1 receptor antagonist on the development of carrageenan-induced pleurisy in the rat. Meyers KP, etal., Inflammation. 1993 Apr;17(2):121-34.
134. Spinal glia and proinflammatory cytokines mediate mirror-image neuropathic pain in rats. Milligan ED, etal., J Neurosci. 2003 Feb 1;23(3):1026-40.
135. Genotype and haplotype determination of IL1B (g. -511C>T and g. +3954C>T) and (IL1RN) in pediatric nephrolithiasis. Mittal RD, etal., Clin Chim Acta. 2007 Apr;379(1-2):42-7. Epub 2006 Dec 15.
136. Association of interleukin-1beta gene and receptor antagonist polymorphisms with calcium oxalate urolithiasis. Mittal RD, etal., J Endourol. 2007 Dec;21(12):1565-70.
137. The inflammatory milieu associated with conjunctivalized cornea and its alteration with IL-1 RA gene therapy. Moore JE, etal., Invest Ophthalmol Vis Sci. 2002 Sep;43(9):2905-15.
138. Pilot study on the effects of high cutoff hemofiltration on the need for norepinephrine in septic patients with acute renal failure. Morgera S, etal., Crit Care Med. 2006 Aug;34(8):2099-104.
139. IL-1 is required for allergen-specific Th2 cell activation and the development of airway hypersensitivity response. Nakae S, etal., Int Immunol. 2003 Apr;15(4):483-90.
140. Plasma exchange therapy for the treatment of Escherichia coli O-157 associated hemolytic uremic syndrome. Nakatani T, etal., Int J Mol Med. 2002 Nov;10(5):585-8.
141. Interleukin 1 beta, tumour necrosis factor-alpha and interleukin 1 receptor antagonist in newly diagnosed insulin-dependent diabetes mellitus: comparison to long-standing diabetes and healthy individuals. Netea MG, etal., Cytokine. 1997 Apr;9(4):284-7.
142. Decreased mortality of severe acute pancreatitis after proximal cytokine blockade. Norman JG, etal., Ann Surg. 1995 Jun;221(6):625-31; discussion 631-4.
143. Substitution at IL1RN and deletion at SLC4A11 segregating with phenotype in familial keratoconus. Nowak DM, etal., Invest Ophthalmol Vis Sci. 2013 Mar 1;54(3):2207-15. doi: 10.1167/iovs.13-11592.
144. OMIM Disease Annotation Pipeline OMIM Disease Annotation Pipeline
145. Interleukin 1 receptor antagonist mediates the antiinflammatory and antifibrotic effect of mesenchymal stem cells during lung injury. Ortiz LA, etal., Proc Natl Acad Sci U S A. 2007 Jun 26;104(26):11002-7. Epub 2007 Jun 14.
146. Distinct sputum cytokine profiles in cystic fibrosis and other chronic inflammatory airway disease. Osika E, etal., Eur Respir J. 1999 Aug;14(2):339-46.
147. Interleukin-1beta mediates the memory impairment associated with a delayed type hypersensitivity response to bacillus Calmette-Guerin in the rat hippocampus. Palin K, etal., Brain Behav Immun. 2004 May;18(3):223-30.
148. Influence of the course of brain inflammation on the endogenous IL-1beta/IL-1Ra balance in the model of brain delayed-type hypersensitivity response to bacillus Calmette-Guerin in Lewis rats. Palin K, etal., J Neuroimmunol. 2004 Apr;149(1-2):22-30.
149. Ibuprofen protects ischemia-induced neuronal injury via up-regulating interleukin-1 receptor antagonist expression. Park EM, etal., Neuroscience. 2005;132(3):625-31.
150. Interleukin-1 receptor antagonist attenuates airway hyperresponsiveness following exposure to ozone. Park JW, etal., Am J Respir Cell Mol Biol. 2004 Jun;30(6):830-6. Epub 2004 Jan 30.
151. Release of anti-inflammatory mediators after major torso trauma correlates with the development of postinjury multiple organ failure. Partrick DA, etal., Am J Surg. 1999 Dec;178(6):564-9.
152. Association between interleukin-1 receptor antagonist gene and asthma-related traits in a German adult population. Pattaro C, etal., Allergy. 2006 Feb;61(2):239-44.
153. Interleukin-1 receptor antagonist intron 2 variable number of tandem repeats polymorphism and respiratory failure in children with community-acquired pneumonia. Patwari PP, etal., Pediatr Crit Care Med. 2008 Nov;9(6):553-9.
154. Effect of acute hyperglycaemia on selected plasma and urinary cytokine antagonists in Type 1 diabetes mellitus. Pelikanova T, etal., Diabetologia. 2003 Apr;46(4):470-4. Epub 2003 Apr 5.
155. IL-1 receptor antagonist (IL-1RA) gene polymorphism in Sjogren's syndrome and rheumatoid arthritis. Perrier S, etal., Clin Immunol Immunopathol. 1998 Jun;87(3):309-13.
156. Differences in the genotypes and plasma concentrations of the INTERLEUKIN-1 receptor antagonist in black and white South African asthmatics and control subjects. Pillay V, etal., Cytokine. 2000 Jun;12(6):819-21.
157. Interleukin-1 accounts for intrarenal Th17 cell activation during ureteral obstruction. Pindjakova J, etal., Kidney Int. 2012 Feb;81(4):379-90. doi: 10.1038/ki.2011.348. Epub 2011 Oct 5.
158. Interleukin-1beta causes fluoxetine resistance in an animal model of epilepsy-associated depression. Pineda EA, etal., Neurotherapeutics. 2012 Apr;9(2):477-85.
159. PID Annotation Import Pipeline Pipeline to import Pathway Interaction Database annotations from NCI into RGD
160. Impact of IL-1 signalling on experimental uveitis and arthritis. Planck SR, etal., Ann Rheum Dis. 2012 May;71(5):753-60. doi: 10.1136/annrheumdis-2011-200556. Epub 2012 Jan 20.
161. Brain cytokine mRNAs in anorectic rats bearing prostate adenocarcinoma tumor cells. Plata-Salaman CR, etal., Am J Physiol. 1998 Aug;275(2 Pt 2):R566-73.
162. Mucosal delivery of anti-inflammatory IL-1Ra by sporulating recombinant bacteria. Porzio S, etal., BMC Biotechnol. 2004 Oct 30;4:27.
163. Delayed administration of interleukin-1 receptor antagonist reduces ischemic brain damage and inflammation in comorbid rats. Pradillo JM, etal., J Cereb Blood Flow Metab. 2012 Sep;32(9):1810-9. doi: 10.1038/jcbfm.2012.101. Epub 2012 Jul 11.
164. Duration and severity of symptoms and levels of plasma interleukin-1 receptor antagonist, soluble tumor necrosis factor receptor, and adhesion molecules in patients with common cold treated with zinc acetate. Prasad AS, etal., J Infect Dis. 2008 Mar 15;197(6):795-802.
165. Inflammatory mediators in Escherichia coli O157:H7 hemorrhagic colitis and hemolytic-uremic syndrome. Proulx F, etal., Pediatr Infect Dis J. 1998 Oct;17(10):899-904.
166. Human immunodeficiency virus-1 coat protein gp120 impairs contextual fear conditioning: a potential role in AIDS related learning and memory impairments. Pugh CR, etal., Brain Res. 2000 Apr 7;861(1):8-15.
167. Interleukin-1R antagonist gene and pre-natal smoke exposure are associated with childhood asthma. Ramadas RA, etal., Eur Respir J. 2007 Mar;29(3):502-8. Epub 2006 Nov 15.
168. ClinVar Automated Import and Annotation Pipeline RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
169. Data Import for Chemical-Gene Interactions RGD automated import pipeline for gene-chemical interactions
170. RGD HPO Phenotype Annotation Pipeline RGD automated import pipeline for human HPO-to-gene-to-disease annotations
171. IL1RN VNTR and IL2-330 polymorphic genes are independently associated with chronic immune thrombocytopenia. Rocha AM, etal., Br J Haematol. 2010 Sep;150(6):679-84. doi: 10.1111/j.1365-2141.2010.08318.x.
172. Interleukin-1 receptor antagonist expression in sarcoidosis. Rolfe MW, etal., Am Rev Respir Dis. 1993 Nov;148(5):1378-84.
173. Decreased proopiomelanocortin mRNA in lymphocytes of chronic alcoholics after intravenous human corticotropin releasing factor injection. Rosenberger P, etal., Alcohol Clin Exp Res. 2003 Nov;27(11):1693-700. doi: 10.1097/01.ALC.0000095636.44770.55.
174. Imbalances in serum proinflammatory cytokines and their soluble receptors: a putative role in the progression of idiopathic IgA nephropathy (IgAN) and Henoch-Schonlein purpura nephritis, and a potential target of immunoglobulin therapy? Rostoker G, etal., Clin Exp Immunol. 1998 Dec;114(3):468-76.
175. Administration of interleukin-1 receptor antagonist ameliorates renal ischemia-reperfusion injury. Rusai K, etal., Transpl Int. 2008 Jun;21(6):572-80. Epub 2008 Mar 18.
176. Interleukin-1 receptor antagonist prevents low dose streptozotocin induced diabetes in mice. Sandberg JO, etal., Biochem Biophys Res Commun. 1994 Jul 15;202(1):543-8.
177. IL-1 receptor antagonist inhibits recurrence of disease after syngeneic pancreatic islet transplantation to spontaneously diabetic non-obese diabetic (NOD) mice. Sandberg JO, etal., Clin Exp Immunol. 1997 May;108(2):314-7.
178. Imbalances between interleukin-1 and tumor necrosis factor agonists and antagonists in stable COPD. Sapey E, etal., J Clin Immunol. 2009 Jul;29(4):508-16. Epub 2009 Mar 17.
179. Neutrophil serine proteases promote IL-1beta generation and injury in necrotizing crescentic glomerulonephritis. Schreiber A, etal., J Am Soc Nephrol. 2012 Mar;23(3):470-82. Epub 2012 Jan 12.
180. Association of interleukin-1beta and interleukin-1 receptor antagonist genes with disease severity in MS. Schrijver HM, etal., Neurology 1999 Feb;52(3):595-9.
181. Regulatory effects of endogenous interleukin-1 receptor antagonist protein in immunoglobulin G immune complex-induced lung injury. Shanley TP, etal., J Clin Invest. 1996 Feb 15;97(4):963-70.
182. Interleukin 1 receptor blockade reduces tumor necrosis factor production, tissue injury, and mortality after hepatic ischemia-reperfusion in the rat. Shito M, etal., Transplantation. 1997 Jan 15;63(1):143-8.
183. Impact of interleukin-1 receptor antagonist and tumor necrosis factor-alpha gene polymorphism on IgA nephropathy. Shu KH, etal., Kidney Int. 2000 Aug;58(2):783-9.
184. Genetic susceptibility to respiratory syncytial virus bronchiolitis in preterm children is associated with airway remodeling genes and innate immune genes. Siezen CL, etal., Pediatr Infect Dis J. 2009 Apr;28(4):333-5.
185. The IL-1 family: regulators of immunity. Sims JE and Smith DE, Nat Rev Immunol. 2010 Feb;10(2):89-102. Epub 2010 Jan 18.
186. Production of interleukin-10 by human bronchogenic carcinoma. Smith DR, etal., Am J Pathol. 1994 Jul;145(1):18-25.
187. Increased interleukin-1 receptor antagonist in idiopathic pulmonary fibrosis. A compartmental analysis. Smith DR, etal., Am J Respir Crit Care Med. 1995 Jun;151(6):1965-73.
188. Genetic variability in the severity and outcome of community-acquired pneumonia. Sole-Violan J, etal., Respir Med. 2010 Mar;104(3):440-7. Epub 2009 Nov 8.
189. Pro- and anti-inflammatory forms of interleukin-1 in the tear fluid and conjunctiva of patients with dry-eye disease. Solomon A, etal., Invest Ophthalmol Vis Sci. 2001 Sep;42(10):2283-92.
190. The role of cytokines in the behavioral responses to endotoxin and influenza virus infection in mice: effects of acute and chronic administration of the interleukin-1-receptor antagonist (IL-1ra). Swiergiel AH, etal., Brain Res. 1997 Nov 21;776(1-2):96-104.
191. Circulating cytokines, chemokines and adhesion molecules in normal pregnancy and preeclampsia determined by multiplex suspension array. Szarka A, etal., BMC Immunol. 2010 Dec 2;11:59.
192. Interleukin-1 receptor antagonist modifies the changes in vital organs induced by acute necrotizing pancreatitis in a rat experimental model. Tanaka N, etal., Crit Care Med. 1995 May;23(5):901-8.
193. Severity of alopecia areata is associated with a polymorphism in the interleukin-1 receptor antagonist gene. Tarlow JK, etal., J Invest Dermatol. 1994 Sep;103(3):387-90.
194. Adenoviral overproduction of interleukin-1 receptor antagonist increases beta cell replication and mass in syngeneically transplanted islets, and improves metabolic outcome. Tellez N, etal., Diabetologia. 2007 Mar;50(3):602-11. Epub 2007 Jan 13.
195. Tobacco smoking associated with the increases of the bronchoalveolar levels of interleukin-5 and interleukin-1 receptor antagonist in acute eosinophilic pneumonia. Teng Y and Gao Y, Eur Rev Med Pharmacol Sci. 2014;18(6):887-93.
196. The detrimental effects of IFN-alpha on vasculogenesis in lupus are mediated by repression of IL-1 pathways: potential role in atherogenesis and renal vascular rarefaction. Thacker SG, etal., J Immunol. 2010 Oct 1;185(7):4457-69. Epub 2010 Aug 30.
197. Balance of pro- and anti-inflammatory cytokines correlates with outcome of acute experimental Pseudomonas aeruginosa keratitis. Thakur A, etal., Infect Immun. 2002 Apr;70(4):2187-97.
198. Evolution of gene expression changes in newborn rats after mechanical ventilation with reversible intubation. Trummer-Menzi E, etal., Pediatr Pulmonol. 2012 Jul 10. doi: 10.1002/ppul.22613.
199. The different expression patterns of interleukin-1 receptor antagonist in systemic lupus erythematosus. Tsai LJ, etal., Tissue Antigens. 2006 Dec;68(6):493-501.
200. Suppression of experimental uveitis by a recombinant adeno-associated virus vector encoding interleukin-1 receptor antagonist. Tsai ML, etal., Mol Vis. 2009 Aug 8;15:1542-52.
201. Imbalances between tumor necrosis factor-alpha and its soluble receptor forms, and interleukin-1beta and interleukin-1 receptor antagonist in BAL fluid of cavitary pulmonary tuberculosis. Tsao TC, etal., Chest. 2000 Jan;117(1):103-9.
202. Soluble TNF-alpha receptor and IL-1 receptor antagonist elevation in BAL in active pulmonary TB. Tsao TC, etal., Eur Respir J. 1999 Sep;14(3):490-5.
203. Interleukin-1 alpha and interleukin-1 receptor antagonist in the urine of children with acute pyelonephritis and relation to renal scarring. Tullus K, etal., Acta Paediatr. 1996 Feb;85(2):158-62.
204. Endotoxin-induced cytokine gene expression in vivo. IV. Expression of interleukin-1 alpha/beta and interleukin-1 receptor antagonist mRNA during endotoxemia and during endotoxin-initiated local acute inflammation. Ulich TR, etal., Am J Pathol. 1992 Jul;141(1):61-8.
205. Haplotypes of IL1B, IL1RN, IL1R1, and IL1R2 and the risk of venous thrombosis. van Minkelen R, etal., Arterioscler Thromb Vasc Biol. 2007 Jun;27(6):1486-91. Epub 2007 Apr 5.
206. Cytokine gene polymorphisms and high-resolution-computed tomography score in idiopathic pulmonary fibrosis. Vasakova M, etal., Respir Med. 2007 May;101(5):944-50. Epub 2006 Oct 23.
207. Interleukin-1 receptor blockade reduces the number and size of murine B16 melanoma hepatic metastases. Vidal-Vanaclocha F, etal., Cancer Res. 1994 May 15;54(10):2667-72.
208. Topical administration of interleukin-1 receptor antagonist as a therapy for aqueous-deficient dry eye in autoimmune disease. Vijmasi T, etal., Mol Vis. 2013 Sep 19;19:1957-65. eCollection 2013.
209. Interleukin-1 receptor antagonist treatment reduces pulmonary hypertension generated in rats by monocrotaline. Voelkel NF, etal., Am J Respir Cell Mol Biol. 1994 Dec;11(6):664-75.
210. Adenovirus expressing interleukin-1 receptor antagonist alleviates allergic airway inflammation in a murine model of asthma. Wang CC, etal., Gene Ther. 2006 Oct;13(19):1414-21. Epub 2006 May 25.
211. Interleukin-1 beta induction of neuron apoptosis depends on p38 mitogen-activated protein kinase activity after spinal cord injury. Wang XJ, etal., Acta Pharmacol Sin. 2005 Aug;26(8):934-42.
212. Association of interleukin-1 receptor antagonist gene polymorphism with IgA nephropathy. Watanabe M, etal., Nephron. 2002 Aug;91(4):744-6.
213. Altered levels of interleukin-1 beta and interleukin-1 receptor antagonist in chronic myelogenous leukemia: clinical and prognostic correlates. Wetzler M, etal., Blood. 1994 Nov 1;84(9):3142-7.
214. Induction of pituitary cytokine transcripts by peripheral lipopolysaccharide. Whiteside MB, etal., J Neuroendocrinol. 1999 Feb;11(2):115-20.
215. Increased risk of fibrosing alveolitis associated with interleukin-1 receptor antagonist and tumor necrosis factor-alpha gene polymorphisms. Whyte M, etal., Am J Respir Crit Care Med. 2000 Aug;162(2 Pt 1):755-8.
216. Influence of polymorphism in the genes for the interleukin (IL)-1 receptor antagonist and IL-1beta on tuberculosis. Wilkinson RJ, etal., J Exp Med. 1999 Jun 21;189(12):1863-74.
217. Genetically modified bone marrow-derived vehicle cells site specifically deliver an anti-inflammatory cytokine to inflamed interstitium of obstructive nephropathy. Yamagishi H, etal., J Immunol. 2001 Jan 1;166(1):609-16.
218. Mesenchymal Stem Cell: Does it Work in an Experimental Model with Acute Respiratory Distress Syndrome? Yilmaz S, etal., Stem Cell Rev. 2012 Jul 19.
219. Prophylaxis of antibody-induced acute glomerulonephritis with genetically modified bone marrow-derived vehicle cells. Yokoo T, etal., Hum Gene Ther. 1999 Nov 1;10(16):2673-8.
220. Rhinovirus regulation of IL-1 receptor antagonist in vivo and in vitro: a potential mechanism of symptom resolution. Yoon HJ, etal., J Immunol. 1999 Jun 15;162(12):7461-9.
221. IL-1 up-regulates osteopontin expression in experimental crescentic glomerulonephritis in the rat. Yu XQ, etal., Am J Pathol. 1999 Mar;154(3):833-41.
222. The experimental treatment of corneal graft rejection with the interleukin-1 receptor antagonist (IL-1ra) gene. Yuan J, etal., PLoS One. 2013 May 28;8(5):e60714. doi: 10.1371/journal.pone.0060714. Print 2013.
223. Association of tumor necrosis factor-alpha and interleukin-1 gene polymorphisms with silicosis. Yucesoy B, etal., Toxicol Appl Pharmacol. 2001 Apr 1;172(1):75-82.
224. Interleukin-1 receptor antagonist gene polymorphism increases susceptibility to septic shock in children with acute lymphoblastic leukemia. Zapata-Tarres M, etal., Pediatr Infect Dis J. 2013 Feb;32(2):136-9. doi: 10.1097/INF.0b013e31827566dd.
225. Association of interleukin-1beta and interleukin-1 receptor antagonist gene polymorphisms in Turkish children with atopic asthma. Zeyrek D, etal., Allergy Asthma Proc. 2008 Sep-Oct;29(5):468-74.
226. Electroacupuncture attenuates bone cancer pain and inhibits spinal interleukin-1 beta expression in a rat model. Zhang RX, etal., Anesth Analg. 2007 Nov;105(5):1482-8, table of contents.
227. Therapeutic effect of exogenous bone marrowderived mesenchymal stem cell transplantation on silicosis via paracrine mechanisms in rats. Zhao MM, etal., Mol Med Rep. 2013 Sep;8(3):741-6. doi: 10.3892/mmr.2013.1580. Epub 2013 Jul 10.
228. Interleukin 6, tumour necrosis factor alpha, interleukin 1beta and interleukin 1 receptor antagonist promoter or coding gene polymorphisms in multiple myeloma. Zheng C, etal., Br J Haematol. 2000 Apr;109(1):39-45.
229. Amniotic-fluid-derived mesenchymal stem cells overexpressing interleukin-1 receptor antagonist improve fulminant hepatic failure. Zheng YB, etal., PLoS One. 2012;7(7):e41392. Epub 2012 Jul 23.
230. Heightened Innate Immune Responses in the Respiratory Tract of COVID-19 Patients. Zhou Z, etal., Cell Host Microbe. 2020 Jun 10;27(6):883-890.e2. doi: 10.1016/j.chom.2020.04.017. Epub 2020 May 4.
231. Expression of cell adhesion molecules on limbal and neovascular endothelium in corneal inflammatory neovascularization. Zhu SN and Dana MR, Invest Ophthalmol Vis Sci. 1999 Jun;40(7):1427-34.
232. Roles of central interleukin-1 on stress-induced-hypertension and footshock-induced-analgesia in rats. Zou CJ, etal., Neurosci Lett. 2001 Sep 21;311(1):41-4.
233. [Prognostic values of serum concentration and urinary excretion of interleukin-1 receptor antagonist and tumor necrosis factor receptors type I and II in patients with IGA nephropathy]. Zwiech R, etal., Pol Arch Med Wewn. 2005 Apr;113(4):326-33.
Additional References at PubMed
PMID:1385987   PMID:1386337   PMID:1479000   PMID:1534997   PMID:1827201   PMID:1828071   PMID:1828896   PMID:1830582   PMID:1834644   PMID:2137200   PMID:2137201   PMID:2139180  
PMID:2143761   PMID:2147937   PMID:7629520   PMID:7867645   PMID:8045306   PMID:8175703   PMID:8188271   PMID:8432529   PMID:8726668   PMID:8852605   PMID:8992991   PMID:9062194  
PMID:9169134   PMID:9185517   PMID:9514884   PMID:9597123   PMID:9710237   PMID:9933103   PMID:10443688   PMID:10512743   PMID:10625660   PMID:10673296   PMID:10744718   PMID:10786823  
PMID:10860666   PMID:10948677   PMID:10988299   PMID:11023482   PMID:11033452   PMID:11045853   PMID:11093146   PMID:11127488   PMID:11138328   PMID:11145836   PMID:11171832   PMID:11233912  
PMID:11247888   PMID:11278614   PMID:11423389   PMID:11466363   PMID:11531943   PMID:11574262   PMID:11600466   PMID:11606494   PMID:11606496   PMID:11640949   PMID:11641511   PMID:11665981  
PMID:11686217   PMID:11762793   PMID:11770040   PMID:11784248   PMID:11793861   PMID:11802774   PMID:11803448   PMID:11816697   PMID:11841485   PMID:11841553   PMID:11846196   PMID:11858187  
PMID:11876744   PMID:11991722   PMID:12044341   PMID:12070246   PMID:12082590   PMID:12082592   PMID:12095061   PMID:12102486   PMID:12105837   PMID:12111633   PMID:12114904   PMID:12115161  
PMID:12115182   PMID:12133467   PMID:12140751   PMID:12160520   PMID:12161036   PMID:12161099   PMID:12164325   PMID:12165808   PMID:12220547   PMID:12239970   PMID:12240899   PMID:12355453  
PMID:12441323   PMID:12445219   PMID:12445604   PMID:12452470   PMID:12453918   PMID:12454835   PMID:12468823   PMID:12472674   PMID:12477932   PMID:12483741   PMID:12496176   PMID:12519748  
PMID:12530098   PMID:12551827   PMID:12568735   PMID:12578333   PMID:12593203   PMID:12595908   PMID:12609525   PMID:12618859   PMID:12624309   PMID:12626603   PMID:12645941   PMID:12667023  
PMID:12667286   PMID:12679428   PMID:12686792   PMID:12694213   PMID:12714264   PMID:12718576   PMID:12722027   PMID:12729191   PMID:12730545   PMID:12730860   PMID:12746420   PMID:12746914  
PMID:12764021   PMID:12768436   PMID:12775358   PMID:12788304   PMID:12794527   PMID:12801479   PMID:12820354   PMID:12824054   PMID:12828754   PMID:12847695   PMID:12854083   PMID:12891537  
PMID:12901853   PMID:12913327   PMID:12919285   PMID:12930389   PMID:12938145   PMID:12958619   PMID:14504049   PMID:14514232   PMID:14521725   PMID:14522096   PMID:14566095   PMID:14568678  
PMID:14585879   PMID:14586324   PMID:14611908   PMID:14632761   PMID:14633943   PMID:14634579   PMID:14634582   PMID:14644395   PMID:14647192   PMID:14652282   PMID:14656692   PMID:14657427  
PMID:14664464   PMID:14669220   PMID:14672899   PMID:14673228   PMID:14734209   PMID:14735144   PMID:14750640   PMID:14982742   PMID:14984963   PMID:14986816   PMID:14997019   PMID:15030461  
PMID:15036245   PMID:15036607   PMID:15056081   PMID:15077300   PMID:15082121   PMID:15127646   PMID:15141093   PMID:15144571   PMID:15170937   PMID:15171792   PMID:15181037   PMID:15184943  
PMID:15188516   PMID:15190266   PMID:15201366   PMID:15205567   PMID:15223609   PMID:15231136   PMID:15233701   PMID:15235132   PMID:15236174   PMID:15241561   PMID:15247172   PMID:15250242  
PMID:15266130   PMID:15270852   PMID:15286433   PMID:15292002   PMID:15305821   PMID:15318032   PMID:15325407   PMID:15338333   PMID:15339690   PMID:15379752   PMID:15457475   PMID:15476179  
PMID:15485792   PMID:15489334   PMID:15507960   PMID:15507961   PMID:15512788   PMID:15530901   PMID:15535834   PMID:15540224   PMID:15551344   PMID:15562761   PMID:15566952   PMID:15570075  
PMID:15574426   PMID:15579481   PMID:15602586   PMID:15610073   PMID:15644653   PMID:15670034   PMID:15672946   PMID:15679582   PMID:15694997   PMID:15704154   PMID:15717635   PMID:15723707  
PMID:15727567   PMID:15730917   PMID:15733644   PMID:15749898   PMID:15766560   PMID:15797878   PMID:15800325   PMID:15803022   PMID:15830637   PMID:15836820   PMID:15851404   PMID:15866604  
PMID:15878285   PMID:15884119   PMID:15885804   PMID:15900570   PMID:15923123   PMID:15927855   PMID:15931231   PMID:15943888   PMID:15954918   PMID:15986200   PMID:16019127   PMID:16019233  
PMID:16025481   PMID:16026159   PMID:16043936   PMID:16053468   PMID:16078996   PMID:16088107   PMID:16096333   PMID:16098232   PMID:16100774   PMID:16106254   PMID:16109659   PMID:16114018  
PMID:16115908   PMID:16128937   PMID:16142351   PMID:16159520   PMID:16164697   PMID:16172101   PMID:16183821   PMID:16195370   PMID:16200608   PMID:16202742   PMID:16217062   PMID:16226351  
PMID:16244470   PMID:16246569   PMID:16263000   PMID:16268484   PMID:16284368   PMID:16284379   PMID:16301842   PMID:16318998   PMID:16319982   PMID:16335952   PMID:16344560   PMID:16361275  
PMID:16361815   PMID:16362796   PMID:16369899   PMID:16389181   PMID:16403098   PMID:16405550   PMID:16414081   PMID:16423338   PMID:16436009   PMID:16454826   PMID:16456536   PMID:16510430  
PMID:16519819   PMID:16538639   PMID:16540751   PMID:16550552   PMID:16553947   PMID:16573560   PMID:16579840   PMID:16595248   PMID:16596202   PMID:16635219   PMID:16635751   PMID:16636119  
PMID:16637265   PMID:16638698   PMID:16699452   PMID:16741227   PMID:16764597   PMID:16769128   PMID:16777324   PMID:16804398   PMID:16815316   PMID:16817913   PMID:16820326   PMID:16820919  
PMID:16824064   PMID:16839849   PMID:16842617   PMID:16856121   PMID:16873708   PMID:16879054   PMID:16885604   PMID:16886894   PMID:16900886   PMID:16905295   PMID:16906455   PMID:16907768  
PMID:16911569   PMID:16921503   PMID:16937503   PMID:16938461   PMID:16980335   PMID:16984283   PMID:16985030   PMID:17002905   PMID:17026469   PMID:17034724   PMID:17035400   PMID:17068065  
PMID:17074546   PMID:17083033   PMID:17096351   PMID:17113632   PMID:17114844   PMID:17115419   PMID:17174563   PMID:17177339   PMID:17182583   PMID:17207379   PMID:17222831   PMID:17235630  
PMID:17256873   PMID:17257312   PMID:17290743   PMID:17292896   PMID:17295877   PMID:17309751   PMID:17314118   PMID:17324969   PMID:17327408   PMID:17332449   PMID:17335371   PMID:17348243  
PMID:17351514   PMID:17359523   PMID:17373677   PMID:17380888   PMID:17388919   PMID:17391700   PMID:17443229   PMID:17444587   PMID:17444864   PMID:17446060   PMID:17448214   PMID:17453104  
PMID:17454884   PMID:17459217   PMID:17482260   PMID:17483707   PMID:17532232   PMID:17548705   PMID:17572155   PMID:17584583   PMID:17592300   PMID:17593860   PMID:17607501   PMID:17607547  
PMID:17610660   PMID:17611547   PMID:17611673   PMID:17618436   PMID:17627763   PMID:17640324   PMID:17645476   PMID:17656565   PMID:17703412   PMID:17716546   PMID:17760842   PMID:17846855  
PMID:17847930   PMID:17867984   PMID:17899305   PMID:17900737   PMID:17903994   PMID:17907045   PMID:17914732   PMID:17948066   PMID:17959519   PMID:17963170   PMID:17964974   PMID:17993728  
PMID:18008080   PMID:18029348   PMID:18038187   PMID:18047563   PMID:18052703   PMID:18052726   PMID:18063673   PMID:18069935   PMID:18086767   PMID:18165865   PMID:18180150   PMID:18239554  
PMID:18243027   PMID:18271063   PMID:18272394   PMID:18278133   PMID:18288276   PMID:18288454   PMID:18299273   PMID:18321309   PMID:18322311   PMID:18329282   PMID:18332090   PMID:18333945  
PMID:18336824   PMID:18354254   PMID:18361937   PMID:18385937   PMID:18386294   PMID:18389618   PMID:18396210   PMID:18416755   PMID:18423886   PMID:18451331   PMID:18455629   PMID:18464913  
PMID:18468936   PMID:18471873   PMID:18484169   PMID:18484691   PMID:18494930   PMID:18496214   PMID:18545091   PMID:18551993   PMID:18565646   PMID:18572364   PMID:18581280   PMID:18583979  
PMID:18589098   PMID:18597398   PMID:18624935   PMID:18632425   PMID:18633131   PMID:18665932   PMID:18666137   PMID:18676680   PMID:18688110   PMID:18702109   PMID:18703194   PMID:18715339  
PMID:18723088   PMID:18728809   PMID:18754838   PMID:18761558   PMID:18771989   PMID:18773331   PMID:18779738   PMID:18782283   PMID:18805892   PMID:18807132   PMID:18808736   PMID:18810365  
PMID:18814951   PMID:18815552   PMID:18818748   PMID:18821666   PMID:18832862   PMID:18853133   PMID:18940468   PMID:18942754   PMID:18987561   PMID:19004046   PMID:19009622   PMID:19012493  
PMID:19013788   PMID:19019335   PMID:19026124   PMID:19026700   PMID:19030199   PMID:19031173   PMID:19046297   PMID:19053923   PMID:19056867   PMID:19058789   PMID:19066720   PMID:19073760  
PMID:19074885   PMID:19076825   PMID:19086955   PMID:19102413   PMID:19111743   PMID:19117745   PMID:19125864   PMID:19127455   PMID:19129082   PMID:19132772   PMID:19134476   PMID:19135625  
PMID:19141860   PMID:19142372   PMID:19151976   PMID:19170196   PMID:19191798   PMID:19203086   PMID:19247692   PMID:19258032   PMID:19267917   PMID:19269948   PMID:19272615   PMID:19290009  
PMID:19290417   PMID:19295440   PMID:19322919   PMID:19332120   PMID:19334424   PMID:19336370   PMID:19336475   PMID:19338208   PMID:19347053   PMID:19375283   PMID:19399323   PMID:19408823  
PMID:19418669   PMID:19419456   PMID:19427781   PMID:19431193   PMID:19453261   PMID:19470040   PMID:19494218   PMID:19495883   PMID:19497711   PMID:19505916   PMID:19505919   PMID:19506726  
PMID:19527514   PMID:19544559   PMID:19544973   PMID:19550417   PMID:19573080   PMID:19574724   PMID:19594368   PMID:19603010   PMID:19607807   PMID:19618316   PMID:19625176   PMID:19638314  
PMID:19643686   PMID:19644155   PMID:19664671   PMID:19683555   PMID:19684156   PMID:19692168   PMID:19701653   PMID:19706048   PMID:19711225   PMID:19729601   PMID:19733643   PMID:19733878  
PMID:19764937   PMID:19773279   PMID:19804405   PMID:19811432   PMID:19811433   PMID:19811434   PMID:19818512   PMID:19820020   PMID:19822419   PMID:19822442   PMID:19839644   PMID:19844779  
PMID:19850242   PMID:19860911   PMID:19876593   PMID:19889076   PMID:19892918   PMID:19904560   PMID:19909950   PMID:19913121   PMID:19925477   PMID:19930406   PMID:19934104   PMID:19948975  
PMID:20002810   PMID:20005085   PMID:20012999   PMID:20032313   PMID:20034444   PMID:20056442   PMID:20070880   PMID:20080142   PMID:20087638   PMID:20092400   PMID:20113413   PMID:20131253  
PMID:20140262   PMID:20141484   PMID:20169140   PMID:20175886   PMID:20178882   PMID:20185814   PMID:20188863   PMID:20192980   PMID:20193596   PMID:20196868   PMID:20200422   PMID:20207250  
PMID:20213229   PMID:20213597   PMID:20237151   PMID:20237496   PMID:20305143   PMID:20334849   PMID:20335539   PMID:20347268   PMID:20353565   PMID:20364673   PMID:20378664   PMID:20379614  
PMID:20399384   PMID:20400062   PMID:20412719   PMID:20427258   PMID:20450372   PMID:20452482   PMID:20453000   PMID:20463618   PMID:20467172   PMID:20472930   PMID:20482626   PMID:20484876  
PMID:20485444   PMID:20486195   PMID:20495422   PMID:20503287   PMID:20536609   PMID:20564140   PMID:20568250   PMID:20581747   PMID:20592454   PMID:20595916   PMID:20603050   PMID:20621920  
PMID:20628086   PMID:20630038   PMID:20631624   PMID:20650788   PMID:20654748   PMID:20673868   PMID:20709104   PMID:20734064   PMID:20800651   PMID:20802378   PMID:20837746   PMID:20839488  
PMID:20863445   PMID:20880168   PMID:20880945   PMID:20934174   PMID:20940514   PMID:20942594   PMID:20975573   PMID:21035110   PMID:21037510   PMID:21044950   PMID:21048327   PMID:21049406  
PMID:21054807   PMID:21086908   PMID:21111725   PMID:21174170   PMID:21182747   PMID:21235388   PMID:21241861   PMID:21243433   PMID:21248262   PMID:21265111   PMID:21278303   PMID:21357189  
PMID:21394384   PMID:21455057   PMID:21523343   PMID:21558284   PMID:21575667   PMID:21591983   PMID:21621860   PMID:21655939   PMID:21671260   PMID:21768915   PMID:21848462   PMID:21873635  
PMID:21968104   PMID:21980458   PMID:22032624   PMID:22035161   PMID:22059992   PMID:22127713   PMID:22205395   PMID:22267087   PMID:22285242   PMID:22286731   PMID:22312160   PMID:22322675  
PMID:22327782   PMID:22370044   PMID:22431772   PMID:22455686   PMID:22498095   PMID:22537067   PMID:22744645   PMID:22753384   PMID:22829643   PMID:22882407   PMID:22909148   PMID:22939635  
PMID:22948742   PMID:23009887   PMID:23013217   PMID:23028694   PMID:23049596   PMID:23049925   PMID:23053980   PMID:23122308   PMID:23168096   PMID:23192617   PMID:23195019   PMID:23212299  
PMID:23251650   PMID:23251661   PMID:23308180   PMID:23323013   PMID:23363559   PMID:23376485   PMID:23388595   PMID:23406623   PMID:23449693   PMID:23472661   PMID:23499887   PMID:23554905  
PMID:23562526   PMID:23577098   PMID:23584371   PMID:23592003   PMID:23602199   PMID:23602982   PMID:23609451   PMID:23633206   PMID:23743874   PMID:23749763   PMID:23765978   PMID:23800434  
PMID:23818854   PMID:23823136   PMID:23849770   PMID:23953530   PMID:23954849   PMID:23969696   PMID:23991111   PMID:23999825   PMID:24014495   PMID:24055697   PMID:24162774   PMID:24182552  
PMID:24233813   PMID:24274595   PMID:24322806   PMID:24446526   PMID:24446657   PMID:24465880   PMID:24490166   PMID:24504887   PMID:24534280   PMID:24557417   PMID:24563688   PMID:24588341  
PMID:24592969   PMID:24603878   PMID:24611340   PMID:24680088   PMID:24771848   PMID:24819208   PMID:24840811   PMID:24850227   PMID:24905619   PMID:24918527   PMID:24933945   PMID:24952603  
PMID:24969107   PMID:24998848   PMID:25073651   PMID:25080789   PMID:25089931   PMID:25124963   PMID:25174605   PMID:25201247   PMID:25207923   PMID:25223242   PMID:25286391   PMID:25292060  
PMID:25331947   PMID:25422100   PMID:25461401   PMID:25466956   PMID:25500257   PMID:25530139   PMID:25542762   PMID:25616863   PMID:25726324   PMID:25738940   PMID:25821855   PMID:25826984  
PMID:26003199   PMID:26046681   PMID:26097611   PMID:26101331   PMID:26158606   PMID:26186194   PMID:26269955   PMID:26279136   PMID:26316104   PMID:26330006   PMID:26445016   PMID:26449434  
PMID:26474296   PMID:26487586   PMID:26500244   PMID:26502861   PMID:26521731   PMID:26555681   PMID:26610735   PMID:26612588   PMID:26646252   PMID:26654556   PMID:26813462   PMID:26831858  
PMID:26861613   PMID:26972847   PMID:26994310   PMID:27031441   PMID:27061312   PMID:27105431   PMID:27116880   PMID:27138824   PMID:27340011   PMID:27400406   PMID:27432980   PMID:27436278  
PMID:27538648   PMID:27717726   PMID:27769857   PMID:28083609   PMID:28110439   PMID:28129679   PMID:28252571   PMID:28293435   PMID:28296777   PMID:28342152   PMID:28370589   PMID:28383060  
PMID:28384207   PMID:28405733   PMID:28428221   PMID:28514442   PMID:28593919   PMID:28612927   PMID:28682145   PMID:28972805   PMID:29023524   PMID:29047186   PMID:29117667   PMID:29169428  
PMID:29226727   PMID:29235261   PMID:29281611   PMID:29339698   PMID:29395365   PMID:29425823   PMID:29454070   PMID:29620037   PMID:29718011   PMID:29802240   PMID:29943912   PMID:29949333  
PMID:29968322   PMID:30075593   PMID:30095747   PMID:30360750   PMID:30375100   PMID:30382562   PMID:30523673   PMID:30593746   PMID:30779222   PMID:30969811   PMID:30978442   PMID:30995661  
PMID:31002437   PMID:31059114   PMID:31102307   PMID:31125901   PMID:31294845   PMID:31299415   PMID:31357078   PMID:31444012   PMID:31550242   PMID:31554783   PMID:31650822   PMID:31693463  
PMID:31698971   PMID:31846791   PMID:31852669   PMID:31854275   PMID:31953354   PMID:32020215   PMID:32148206   PMID:32170523   PMID:32185578   PMID:32204425   PMID:32282310   PMID:32319224  
PMID:32470060   PMID:32526258   PMID:32657162   PMID:32739831   PMID:32790111   PMID:32881904   PMID:33128925   PMID:33238942   PMID:33464542   PMID:33466672   PMID:33480001   PMID:33961781  
PMID:34002010   PMID:34070905   PMID:34363079   PMID:34732716   PMID:34741549   PMID:34897107   PMID:34990893   PMID:35066451   PMID:35272075   PMID:35843124   PMID:35843146   PMID:35906200  
PMID:36028805   PMID:36316862   PMID:36518750   PMID:36591308   PMID:37198429   PMID:37461111   PMID:37644369   PMID:37657716   PMID:37803493   PMID:38139317   PMID:38203822   PMID:38742942  
PMID:38875998  


Genomics

Comparative Map Data
IL1RN
(Homo sapiens - human)
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh382113,099,360 - 113,134,014 (+)NCBIGRCh38GRCh38hg38GRCh38
GRCh38.p14 Ensembl2113,099,315 - 113,134,016 (+)EnsemblGRCh38hg38GRCh38
GRCh372113,875,548 - 113,891,591 (+)NCBIGRCh37GRCh37hg19GRCh37
Build 362113,591,941 - 113,608,064 (+)NCBINCBI36Build 36hg18NCBI36
Build 342113,591,700 - 113,607,823NCBI
Celera2107,260,159 - 107,276,191 (+)NCBICelera
Cytogenetic Map2q14.1NCBI
HuRef2106,329,950 - 106,345,897 (+)NCBIHuRef
CHM1_12113,879,899 - 113,896,017 (+)NCBICHM1_1
T2T-CHM13v2.02113,544,556 - 113,560,594 (+)NCBIT2T-CHM13v2.0
Il1rn
(Mus musculus - house mouse)
Mouse AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCm39224,226,872 - 24,241,503 (+)NCBIGRCm39GRCm39mm39
GRCm39 Ensembl224,226,865 - 24,241,506 (+)EnsemblGRCm39 Ensembl
GRCm38224,336,860 - 24,351,491 (+)NCBIGRCm38GRCm38mm10GRCm38
GRCm38.p6 Ensembl224,336,853 - 24,351,494 (+)EnsemblGRCm38mm10GRCm38
MGSCv37224,192,380 - 24,207,011 (+)NCBIGRCm37MGSCv37mm9NCBIm37
MGSCv36224,158,869 - 24,173,490 (+)NCBIMGSCv36mm8
Celera224,056,294 - 24,070,923 (+)NCBICelera
Cytogenetic Map2A3NCBI
cM Map216.36NCBI
Il1rn
(Rattus norvegicus - Norway rat)
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCr8327,509,836 - 27,525,738 (+)NCBIGRCr8
mRatBN7.237,111,567 - 7,127,451 (+)NCBImRatBN7.2mRatBN7.2
mRatBN7.2 Ensembl37,111,550 - 7,127,445 (+)EnsemblmRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx310,225,656 - 10,231,090 (+)NCBIRnor_SHRUTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0318,811,887 - 18,817,327 (+)NCBIRnor_SHRSPUTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0317,001,698 - 17,007,132 (+)NCBIRnor_WKYUTH_Rnor_WKY_Bbb_1.0
Rnor_6.031,449,778 - 1,468,624 (+)NCBIRnor6.0Rnor_6.0rn6Rnor6.0
Rnor_6.0 Ensembl31,452,644 - 1,468,614 (+)EnsemblRnor6.0rn6Rnor6.0
Rnor_5.031,445,598 - 1,461,452 (+)NCBIRnor5.0Rnor_5.0rn5Rnor5.0
RGSC_v3.432,607,800 - 2,613,216 (+)NCBIRGSC3.4RGSC_v3.4rn4RGSC3.4
RGSC_v3.132,607,803 - 2,611,842 (+)NCBI
Celera31,959,290 - 1,964,693 (+)NCBICelera
Cytogenetic Map3p13NCBI
Il1rn
(Chinchilla lanigera - long-tailed chinchilla)
Chinchilla AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChiLan1.0 EnsemblNW_0049554701,144,810 - 1,159,471 (-)EnsemblChiLan1.0
ChiLan1.0NW_0049554701,145,022 - 1,159,413 (-)NCBIChiLan1.0ChiLan1.0
IL1RN
(Pan paniscus - bonobo/pygmy chimpanzee)
Bonobo AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
NHGRI_mPanPan1-v21215,056,807 - 15,073,265 (-)NCBINHGRI_mPanPan1-v2
NHGRI_mPanPan12A15,059,572 - 15,065,747 (-)NCBINHGRI_mPanPan1
Mhudiblu_PPA_v02A88,991,646 - 89,008,013 (-)NCBIMhudiblu_PPA_v0Mhudiblu_PPA_v0panPan3
PanPan1.12A114,061,182 - 114,077,048 (+)NCBIpanpan1.1PanPan1.1panPan2
PanPan1.1 Ensembl2A114,061,182 - 114,078,839 (+)Ensemblpanpan1.1panPan2
IL1RN
(Canis lupus familiaris - dog)
Dog AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
CanFam3.11737,236,690 - 37,250,424 (+)NCBICanFam3.1CanFam3.1canFam3CanFam3.1
CanFam3.1 Ensembl1737,212,751 - 37,249,329 (+)EnsemblCanFam3.1canFam3CanFam3.1
Dog10K_Boxer_Tasha1737,014,575 - 37,019,617 (+)NCBIDog10K_Boxer_Tasha
ROS_Cfam_1.01738,014,380 - 38,028,164 (+)NCBIROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl1738,014,324 - 38,027,492 (+)EnsemblROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.11737,157,832 - 37,162,873 (+)NCBIUMICH_Zoey_3.1
UNSW_CanFamBas_1.01737,214,332 - 37,219,374 (+)NCBIUNSW_CanFamBas_1.0
UU_Cfam_GSD_1.01737,426,795 - 37,431,843 (+)NCBIUU_Cfam_GSD_1.0
Il1rn
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)
Squirrel AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HiC_Itri_2NW_02440629282,552,650 - 82,571,860 (+)NCBIHiC_Itri_2
SpeTri2.0 EnsemblNW_0049367831,447,106 - 1,466,340 (+)EnsemblSpeTri2.0SpeTri2.0 Ensembl
SpeTri2.0NW_0049367831,447,158 - 1,466,331 (+)NCBISpeTri2.0SpeTri2.0SpeTri2.0
IL1RN
(Sus scrofa - pig)		 No map positions available.
IL1RN
(Chlorocebus sabaeus - green monkey)
Green Monkey AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChlSab1.11416,136,667 - 16,152,451 (+)NCBIChlSab1.1ChlSab1.1chlSab2
ChlSab1.1 Ensembl1416,146,333 - 16,151,326 (+)EnsemblChlSab1.1ChlSab1.1 EnsemblchlSab2
Vero_WHO_p1.0NW_0236660803,528,175 - 3,543,946 (-)NCBIVero_WHO_p1.0Vero_WHO_p1.0
Il1rn
(Heterocephalus glaber - naked mole-rat)
Naked Mole-Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HetGla_female_1.0 EnsemblNW_00462474913,210,476 - 13,225,890 (+)EnsemblHetGla_female_1.0HetGla_female_1.0 EnsemblhetGla2
HetGla 1.0NW_00462474913,210,365 - 13,224,471 (+)NCBIHetGla_female_1.0HetGla 1.0hetGla2

Variants

.
Variants in IL1RN
224 total Variants

Clinical Variants
Name Type Condition(s) Position(s) Clinical significance
NM_173842.3(IL1RN):c.206-516ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACATCCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC[2] microsatellite Gastric cancer susceptibility after h. pylori infection [RCV000015787]|Microvascular complications of diabetes, susceptibility to, 4 [RCV000015788] Chr2:113130529..113130700 [GRCh38]
Chr2:113888106..113888277 [GRCh37]
Chr2:2q14.1		 pathogenic|risk factor
IL1RN, 2-BP DEL, 156CA deletion Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000015791] Chr2:2q14.2 pathogenic
NC_000002.12:g.112960554_113135775del deletion Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000015792] Chr2:2q14.2 pathogenic
NM_173842.3(IL1RN):c.229G>T (p.Glu77Ter) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000015789]|not provided [RCV000084165] Chr2:113131068 [GRCh38]
Chr2:113888645 [GRCh37]
Chr2:2q14.1		 pathogenic|not provided
NM_173842.3(IL1RN):c.160C>T (p.Gln54Ter) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000015790]|not provided [RCV000084164] Chr2:113129619 [GRCh38]
Chr2:113887196 [GRCh37]
Chr2:2q14.1		 pathogenic|not provided
NM_173841.2(IL1RN):c.442T>G (p.Phe148Val) single nucleotide variant Malignant melanoma [RCV000060302] Chr2:113132770 [GRCh38]
Chr2:113890347 [GRCh37]
Chr2:113606818 [NCBI36]
Chr2:2q14.1		 not provided
NM_173842.3(IL1RN):c.156_157del (p.Asn52fs) deletion Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001857408]|not provided [RCV000084163] Chr2:113129614..113129615 [GRCh38]
Chr2:113887191..113887192 [GRCh37]
Chr2:2q14.1		 pathogenic|not provided
NM_173842.1(IL1RN):c.-64_1696del deletion not provided [RCV000162093] Chr2:113127561..113134033 [GRCh38]
Chr2:113885138..113891610 [GRCh37]
Chr2:2q14.1		 not provided
GRCh38/hg38 2q14.1(chr2:112924872-113105404)x1 copy number loss See cases [RCV000053808] Chr2:112924872..113105404 [GRCh38]
Chr2:113682449..113862981 [GRCh37]
Chr2:113398920..113579452 [NCBI36]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.*1039C>T single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000260421] Chr2:113133910 [GRCh38]
Chr2:113891487 [GRCh37]
Chr2:2q14.1		 likely benign|uncertain significance
NM_173842.3(IL1RN):c.459C>T (p.Asp153=) single nucleotide variant Autoinflammatory syndrome [RCV002263602]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000386219]|not provided [RCV004710836] Chr2:113132796 [GRCh38]
Chr2:113890373 [GRCh37]
Chr2:2q14.1		 benign|likely benign
NM_173842.3(IL1RN):c.171T>C (p.Ala57=) single nucleotide variant Autoinflammatory syndrome [RCV002263601]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000389038]|not provided [RCV001723919]|not specified [RCV000455594] Chr2:113129630 [GRCh38]
Chr2:113887207 [GRCh37]
Chr2:2q14.1		 benign
NM_173841.3(IL1RN):c.-31A>G single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000264084]|not provided [RCV001718697]|not specified [RCV003401349] Chr2:113117988 [GRCh38]
Chr2:113875565 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.318+12C>G single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000275837] Chr2:113131169 [GRCh38]
Chr2:113888746 [GRCh37]
Chr2:2q14.1		 conflicting interpretations of pathogenicity|uncertain significance
NM_173842.3(IL1RN):c.529G>A (p.Glu177Lys) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000282452]|not provided [RCV001706542]|not specified [RCV001731611] Chr2:113132866 [GRCh38]
Chr2:113890443 [GRCh37]
Chr2:2q14.1		 likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_173841.3(IL1RN):c.73+8A>C single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000364652]|not provided [RCV001653604]|not specified [RCV000455023] Chr2:113120136 [GRCh38]
Chr2:113877713 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.390T>C (p.Ser130=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000330957]|not provided [RCV001643028]|not specified [RCV000454505] Chr2:113132727 [GRCh38]
Chr2:113890304 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.116+5G>A single nucleotide variant Autoinflammatory syndrome [RCV002263600]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000325166] Chr2:113127745 [GRCh38]
Chr2:113885322 [GRCh37]
Chr2:2q14.1		 benign|likely benign
GRCh37/hg19 2q12.2-14.1(chr2:106423310-115054828)x1 copy number loss See cases [RCV000240053] Chr2:106423310..115054828 [GRCh37]
Chr2:2q12.2-14.1		 pathogenic
NM_173842.3(IL1RN):c.*138C>G single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000279064]|not provided [RCV001653605]|not specified [RCV003401350] Chr2:113133009 [GRCh38]
Chr2:113890586 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.69G>A (p.Thr23=) single nucleotide variant Autoinflammatory syndrome [RCV002263599]|Inborn genetic diseases [RCV003352841]|Microvascular complications of diabetes, susceptibility to, 4 [RCV002480172]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000269844]|not provided [RCV000658875] Chr2:113127693 [GRCh38]
Chr2:113885270 [GRCh37]
Chr2:2q14.1		 benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
GRCh37/hg19 2q12.3-14.3(chr2:109798247-125658380)x1 copy number loss See cases [RCV000240485] Chr2:109798247..125658380 [GRCh37]
Chr2:2q12.3-14.3		 pathogenic
NM_173842.3(IL1RN):c.*691del deletion Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000275491] Chr2:113133553 [GRCh38]
Chr2:113891130 [GRCh37]
Chr2:2q14.1		 uncertain significance
GRCh37/hg19 2q12.3-14.1(chr2:109556627-117570152)x1 copy number loss See cases [RCV000240490] Chr2:109556627..117570152 [GRCh37]
Chr2:2q12.3-14.1		 pathogenic
NM_173842.3(IL1RN):c.370G>A (p.Ala124Thr) single nucleotide variant Autoinflammatory syndrome [RCV002263787]|IL1RN-related disorder [RCV003935482]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000550180]|not provided [RCV002223870] Chr2:113132707 [GRCh38]
Chr2:113132707..113132708 [GRCh38]
Chr2:113890284 [GRCh37]
Chr2:113890284..113890285 [GRCh37]
Chr2:2q14.1		 benign|conflicting interpretations of pathogenicity|uncertain significance
NM_173842.3(IL1RN):c.*130C>T single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000373524] Chr2:113133001 [GRCh38]
Chr2:113890578 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.*601C>G single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000315277] Chr2:113133472 [GRCh38]
Chr2:113891049 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.*964G>A single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000355397]|not provided [RCV004708367] Chr2:113133835 [GRCh38]
Chr2:113891412 [GRCh37]
Chr2:2q14.1		 benign
NM_173841.2(IL1RN):c.-87G>A single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000402395]|not provided [RCV001613074]|not specified [RCV003401348] Chr2:113117932 [GRCh38]
Chr2:113875509 [GRCh37]
Chr2:2q14.1		 benign
NM_173841.2(IL1RN):c.-83G>A single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000304296] Chr2:113117936 [GRCh38]
Chr2:113875513 [GRCh37]
Chr2:2q14.1		 likely benign|uncertain significance
NM_173842.3(IL1RN):c.*119C>T single nucleotide variant Autoinflammatory syndrome [RCV002263603]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000318920] Chr2:113132990 [GRCh38]
Chr2:113890567 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.*958C>T single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000319231] Chr2:113133829 [GRCh38]
Chr2:113891406 [GRCh37]
Chr2:2q14.1		 benign|uncertain significance
NM_173841.2(IL1RN):c.-71A>G single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000359043] Chr2:113117948 [GRCh38]
Chr2:113875525 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.*310T>C single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000340072] Chr2:113133181 [GRCh38]
Chr2:113890758 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.*162C>T single nucleotide variant Autoinflammatory syndrome [RCV002263604]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000343482]|not provided [RCV004708366] Chr2:113133033 [GRCh38]
Chr2:113890610 [GRCh37]
Chr2:2q14.1		 benign|likely benign|uncertain significance
NM_173842.3(IL1RN):c.*382C>T single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000364326] Chr2:113133253 [GRCh38]
Chr2:113890830 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173841.3(IL1RN):c.-12G>C single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000309920]|not provided [RCV001618583]|not specified [RCV000454566] Chr2:113118007 [GRCh38]
Chr2:113875584 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.*644del deletion Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000370119] Chr2:113133515 [GRCh38]
Chr2:113891092 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.*311G>A single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000394829] Chr2:113133182 [GRCh38]
Chr2:113890759 [GRCh37]
Chr2:2q14.1		 benign|likely benign
GRCh37/hg19 2p25.3-q37.3(chr2:14238-243048760)x3 copy number gain not provided [RCV000752802] Chr2:14238..243048760 [GRCh37]
Chr2:2p25.3-q37.3		 pathogenic
NM_173842.3(IL1RN):c.*1049A>G single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000379765] Chr2:113133920 [GRCh38]
Chr2:113891497 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.*490del deletion Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000398420] Chr2:113133351 [GRCh38]
Chr2:113890928 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.*1040G>A single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000315607] Chr2:113133911 [GRCh38]
Chr2:113891488 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.*245G>A single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000284512] Chr2:113133116 [GRCh38]
Chr2:113890693 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173841.2(IL1RN):c.*1145A>G single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000285357] Chr2:113134016 [GRCh38]
Chr2:113891593 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.*369T>A single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000309586] Chr2:113133240 [GRCh38]
Chr2:113890817 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.*165C>T single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000394827] Chr2:113133036 [GRCh38]
Chr2:113890613 [GRCh37]
Chr2:2q14.1		 uncertain significance
GRCh37/hg19 2q13(chr2:113735617-113891118)x1 copy number loss See cases [RCV000448884] Chr2:113735617..113891118 [GRCh37]
Chr2:2q13		 benign
GRCh37/hg19 2p25.3-q37.3(chr2:12771-242783384) copy number gain See cases [RCV000512056] Chr2:12771..242783384 [GRCh37]
Chr2:2p25.3-q37.3		 pathogenic
GRCh37/hg19 2p25.3-q37.3(chr2:12771-242783384)x3 copy number gain See cases [RCV000511212] Chr2:12771..242783384 [GRCh37]
Chr2:2p25.3-q37.3		 pathogenic
NM_173842.3(IL1RN):c.79C>T (p.Pro27Ser) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000646721] Chr2:113127703 [GRCh38]
Chr2:113885280 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.245T>A (p.Phe82Tyr) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000646722] Chr2:113131084 [GRCh38]
Chr2:113888661 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.237T>C (p.His79=) single nucleotide variant Autoinflammatory syndrome [RCV002263898]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000646723]|not provided [RCV004708976] Chr2:113131076 [GRCh38]
Chr2:113888653 [GRCh37]
Chr2:2q14.1		 benign|likely benign
NM_173842.3(IL1RN):c.465C>T (p.Pro155=) single nucleotide variant Autoinflammatory syndrome [RCV002263899]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000646724]|not provided [RCV004710178] Chr2:113132802 [GRCh38]
Chr2:113890379 [GRCh37]
Chr2:2q14.1		 benign|likely benign
NM_173842.3(IL1RN):c.205+242C>T single nucleotide variant Autoinflammatory syndrome [RCV002263900]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000646725]|not provided [RCV001724114] Chr2:113129906 [GRCh38]
Chr2:113887483 [GRCh37]
Chr2:2q14.1		 benign
GRCh37/hg19 2q12.1-24.3(chr2:104172062-168223828)x1 copy number loss Poly (ADP-Ribose) polymerase inhibitor response [RCV000626436] Chr2:104172062..168223828 [GRCh37]
Chr2:2q12.1-24.3		 drug response
NM_173842.3(IL1RN):c.62C>G (p.Ser21Ter) single nucleotide variant not provided [RCV000512716] Chr2:113127686 [GRCh38]
Chr2:113885263 [GRCh37]
Chr2:2q14.1		 likely pathogenic
NM_173842.3(IL1RN):c.23G>A (p.Arg8His) single nucleotide variant not provided [RCV000513390] Chr2:113127647 [GRCh38]
Chr2:113885224 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.374T>G (p.Phe125Cys) single nucleotide variant Inborn genetic diseases [RCV004985072]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000686492] Chr2:113132711 [GRCh38]
Chr2:113890288 [GRCh37]
Chr2:2q14.1		 uncertain significance
Single allele deletion not provided [RCV000714264] Chr2:40608411..146900718 [GRCh37]
Chr2:2p22.1-q22.3		 likely pathogenic
NM_173842.3(IL1RN):c.63A>G (p.Ser21=) single nucleotide variant Interstitial lung disease 2 [RCV000677223]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000779276] Chr2:113127687 [GRCh38]
Chr2:113885264 [GRCh37]
Chr2:2q14.1		 conflicting interpretations of pathogenicity|uncertain significance
GRCh37/hg19 2q13(chr2:113698135-114064263)x1 copy number loss not provided [RCV000682066] Chr2:113698135..114064263 [GRCh37]
Chr2:2q13		 uncertain significance
GRCh37/hg19 2q11.1-13(chr2:96353030-114045463)x3 copy number gain not provided [RCV000682168] Chr2:96353030..114045463 [GRCh37]
Chr2:2q11.1-13		 pathogenic
NM_173842.3(IL1RN):c.450G>A (p.Met150Ile) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000694345] Chr2:113132787 [GRCh38]
Chr2:113890364 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173841.3(IL1RN):c.28G>C (p.Gly10Arg) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000687661] Chr2:113120083 [GRCh38]
Chr2:113877660 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173841.3(IL1RN):c.58A>C (p.Asn20His) single nucleotide variant Microvascular complications of diabetes, susceptibility to, 4 [RCV005027862]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000693420] Chr2:113120113 [GRCh38]
Chr2:113877690 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.272G>T (p.Cys91Phe) single nucleotide variant Autoinflammatory syndrome [RCV002263948]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000705510]|not provided [RCV000997195] Chr2:113131111 [GRCh38]
Chr2:113888688 [GRCh37]
Chr2:2q14.1		 uncertain significance
GRCh37/hg19 2p25.3-q37.3(chr2:15672-243101834)x3 copy number gain not provided [RCV000752804] Chr2:15672..243101834 [GRCh37]
Chr2:2p25.3-q37.3		 pathogenic
NM_173841.3(IL1RN):c.10+26T>C single nucleotide variant not provided [RCV001648580]|not specified [RCV003401548] Chr2:113118054 [GRCh38]
Chr2:113875631 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.318+272T>G single nucleotide variant not provided [RCV001667709] Chr2:113131429 [GRCh38]
Chr2:113889006 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.205+158G>A single nucleotide variant not provided [RCV001679872] Chr2:113129822 [GRCh38]
Chr2:113887399 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.339G>A (p.Leu113=) single nucleotide variant not provided [RCV000981805] Chr2:113132676 [GRCh38]
Chr2:113890253 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.117-9C>T single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000929590] Chr2:113129567 [GRCh38]
Chr2:113887144 [GRCh37]
Chr2:2q14.1		 likely benign|conflicting interpretations of pathogenicity
NM_173842.3(IL1RN):c.489C>T (p.Asp163=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000926784] Chr2:113132826 [GRCh38]
Chr2:113890403 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.418G>A (p.Ala140Thr) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001041483]|not provided [RCV004792653] Chr2:113132755 [GRCh38]
Chr2:113890332 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.466G>A (p.Val156Ile) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001041752] Chr2:113132803 [GRCh38]
Chr2:113890380 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.495C>T (p.Gly165=) single nucleotide variant Autoinflammatory syndrome [RCV002264098]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000930942]|not provided [RCV003992423] Chr2:113132832 [GRCh38]
Chr2:113890409 [GRCh37]
Chr2:2q14.1		 likely benign|uncertain significance
NM_173842.3(IL1RN):c.192T>C (p.Asn64=) single nucleotide variant Autoinflammatory syndrome [RCV002264132]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000980969] Chr2:113129651 [GRCh38]
Chr2:113887228 [GRCh37]
Chr2:2q14.1		 likely benign|uncertain significance
NM_173842.3(IL1RN):c.486T>C (p.Pro162=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001497635] Chr2:113132823 [GRCh38]
Chr2:113890400 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.213_227del (p.Asp72_Ile76del) deletion Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000818103] Chr2:113131050..113131064 [GRCh38]
Chr2:113888627..113888641 [GRCh37]
Chr2:2q14.1		 pathogenic|likely pathogenic|uncertain significance
NM_173842.3(IL1RN):c.109G>T (p.Ala37Ser) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000813494] Chr2:113127733 [GRCh38]
Chr2:113885310 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.185G>A (p.Gly62Glu) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000817668]|not provided [RCV004693370] Chr2:113129644 [GRCh38]
Chr2:113887221 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.166G>A (p.Val56Ile) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001132305] Chr2:113129625 [GRCh38]
Chr2:113887202 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.*290T>A single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001134695] Chr2:113133161 [GRCh38]
Chr2:113890738 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.205+8G>A single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001132306] Chr2:113129672 [GRCh38]
Chr2:113887249 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173841.3(IL1RN):c.44G>A (p.Gly15Glu) single nucleotide variant Autoinflammatory syndrome [RCV002264005]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000811873] Chr2:113120099 [GRCh38]
Chr2:113877676 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.426C>T (p.Pro142=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001428761] Chr2:113132763 [GRCh38]
Chr2:113890340 [GRCh37]
Chr2:2q14.1		 likely benign
GRCh37/hg19 2q13(chr2:113717386-113892774)x1 copy number loss not provided [RCV000847007] Chr2:113717386..113892774 [GRCh37]
Chr2:2q13		 pathogenic
NM_173842.3(IL1RN):c.305G>C (p.Arg102Thr) single nucleotide variant Inborn genetic diseases [RCV004986990]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001238669] Chr2:113131144 [GRCh38]
Chr2:113888721 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.220G>A (p.Val74Ile) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001231377] Chr2:113131059 [GRCh38]
Chr2:113888636 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.446C>T (p.Ala149Val) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001226366] Chr2:113132783 [GRCh38]
Chr2:113890360 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173841.3(IL1RN):c.4G>A (p.Ala2Thr) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001226116] Chr2:113118022 [GRCh38]
Chr2:113875599 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.*75C>G single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001133237] Chr2:113132946 [GRCh38]
Chr2:113890523 [GRCh37]
Chr2:2q14.1		 uncertain significance
NC_000002.12:g.(?_113116893)_(113135016_?)del deletion Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001032678] Chr2:113874470..113892593 [GRCh37]
Chr2:2q13		 pathogenic
NM_173841.3(IL1RN):c.11-230G>T single nucleotide variant not provided [RCV001621257] Chr2:113119836 [GRCh38]
Chr2:113877413 [GRCh37]
Chr2:2q14.1		 benign
NM_173841.3(IL1RN):c.11-105G>C single nucleotide variant not provided [RCV001645378]|not specified [RCV003487579] Chr2:113119961 [GRCh38]
Chr2:113877538 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.206-43T>C single nucleotide variant not provided [RCV001720657]|not specified [RCV003401649] Chr2:113131002 [GRCh38]
Chr2:113888579 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.205+21C>T single nucleotide variant not provided [RCV001720671]|not specified [RCV003401651] Chr2:113129685 [GRCh38]
Chr2:113887262 [GRCh37]
Chr2:2q14.1		 benign
NM_173841.3(IL1RN):c.11-148G>T single nucleotide variant not provided [RCV001670476] Chr2:113119918 [GRCh38]
Chr2:113877495 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.318+166T>A single nucleotide variant not provided [RCV001657579] Chr2:113131323 [GRCh38]
Chr2:113888900 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.414T>C (p.Ser138=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000910623] Chr2:113132751 [GRCh38]
Chr2:113890328 [GRCh37]
Chr2:2q14.1		 likely benign|conflicting interpretations of pathogenicity
NM_173841.2(IL1RN):c.*1156T>C single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001132403] Chr2:113134027 [GRCh38]
Chr2:113891604 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.318+327G>A single nucleotide variant not provided [RCV001620214] Chr2:113131484 [GRCh38]
Chr2:113889061 [GRCh37]
Chr2:2q14.1		 benign
NC_000002.12:g.113117851G>A single nucleotide variant not provided [RCV001720659] Chr2:113117851 [GRCh38]
Chr2:113875428 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.205+53G>C single nucleotide variant not provided [RCV001720665]|not specified [RCV003401650] Chr2:113129717 [GRCh38]
Chr2:113887294 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.206-152C>G single nucleotide variant not provided [RCV001720667] Chr2:113130893 [GRCh38]
Chr2:113888470 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.206-157A>G single nucleotide variant not provided [RCV001720672] Chr2:113130888 [GRCh38]
Chr2:113888465 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.205+97A>C single nucleotide variant not provided [RCV001720673]|not specified [RCV003401652] Chr2:113129761 [GRCh38]
Chr2:113887338 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.319-230C>T single nucleotide variant not provided [RCV001709815] Chr2:113132426 [GRCh38]
Chr2:113890003 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.205+94T>G single nucleotide variant not provided [RCV001654596]|not specified [RCV003401555] Chr2:113129758 [GRCh38]
Chr2:113887335 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.*350C>G single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001129689] Chr2:113133221 [GRCh38]
Chr2:113890798 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.318+59A>T single nucleotide variant not provided [RCV001671322]|not specified [RCV003401583] Chr2:113131216 [GRCh38]
Chr2:113888793 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.*537G>A single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001129690] Chr2:113133408 [GRCh38]
Chr2:113890985 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.205+217G>T single nucleotide variant not provided [RCV001666799] Chr2:113129881 [GRCh38]
Chr2:113887458 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.496G>A (p.Val166Ile) single nucleotide variant Microvascular complications of diabetes, susceptibility to, 4 [RCV003224528]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001214883] Chr2:113132833 [GRCh38]
Chr2:113890410 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.169G>T (p.Ala57Ser) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001220016] Chr2:113129628 [GRCh38]
Chr2:113887205 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.*303C>G single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001134696] Chr2:113133174 [GRCh38]
Chr2:113890751 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.68C>T (p.Thr23Met) single nucleotide variant Inborn genetic diseases [RCV004030897]|Microvascular complications of diabetes, susceptibility to, 4 [RCV003224503]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001027789] Chr2:113127692 [GRCh38]
Chr2:113885269 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.*1070T>G single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001132402] Chr2:113133941 [GRCh38]
Chr2:113891518 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.*605T>C single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001129691] Chr2:113133476 [GRCh38]
Chr2:113891053 [GRCh37]
Chr2:2q14.1		 uncertain significance
GRCh37/hg19 2q13(chr2:113853399-114095549)x1 copy number loss not provided [RCV001259646] Chr2:113853399..114095549 [GRCh37]
Chr2:2q13		 pathogenic
NM_173841.3(IL1RN):c.26A>T (p.Glu9Val) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001306761] Chr2:113120081 [GRCh38]
Chr2:113877658 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.449T>C (p.Met150Thr) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001298499] Chr2:113132786 [GRCh38]
Chr2:113890363 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.526G>A (p.Asp176Asn) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001301841] Chr2:113132863 [GRCh38]
Chr2:113890440 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.318+3A>G single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001301399] Chr2:113131160 [GRCh38]
Chr2:113888737 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.212T>C (p.Ile71Thr) single nucleotide variant Microvascular complications of diabetes, susceptibility to, 4 [RCV002486231]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001314665] Chr2:113131051 [GRCh38]
Chr2:113888628 [GRCh37]
Chr2:2q14.1		 uncertain significance
NC_000002.11:g.(?_113877623)_(113877725_?)del deletion Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001348882] Chr2:113877623..113877725 [GRCh37]
Chr2:2q13		 uncertain significance
NM_173842.3(IL1RN):c.331dup (p.Thr111fs) duplication Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001343321] Chr2:113132667..113132668 [GRCh38]
Chr2:113890244..113890245 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.267G>C (p.Lys89Asn) single nucleotide variant Inborn genetic diseases [RCV003166714]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001303678] Chr2:113131106 [GRCh38]
Chr2:113888683 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.197A>G (p.Asn66Ser) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001294372] Chr2:113129656 [GRCh38]
Chr2:113887233 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.528C>T (p.Asp176=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001397160] Chr2:113132865 [GRCh38]
Chr2:113890442 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.379C>T (p.Arg127Cys) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001360906] Chr2:113132716 [GRCh38]
Chr2:113890293 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.500T>A (p.Met167Lys) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001361455] Chr2:113132837 [GRCh38]
Chr2:113890414 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.249G>A (p.Leu83=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001363277] Chr2:113131088 [GRCh38]
Chr2:113888665 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.386_389del (p.Asp129fs) deletion Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001363468] Chr2:113132720..113132723 [GRCh38]
Chr2:113890297..113890300 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.490G>A (p.Glu164Lys) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001363615] Chr2:113132827 [GRCh38]
Chr2:113890404 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.298G>A (p.Glu100Lys) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001324731] Chr2:113131137 [GRCh38]
Chr2:113888714 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.391G>T (p.Gly131Cys) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001370804] Chr2:113132728 [GRCh38]
Chr2:113890305 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.388A>G (p.Ser130Gly) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001340372] Chr2:113132725 [GRCh38]
Chr2:113890302 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.206-4C>G single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001413267] Chr2:113131041 [GRCh38]
Chr2:113888618 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.219G>A (p.Val73=) single nucleotide variant IL1RN-related disorder [RCV003931027]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001502332] Chr2:113131058 [GRCh38]
Chr2:113888635 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.141C>G (p.Thr47=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001500332] Chr2:113129600 [GRCh38]
Chr2:113887177 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173841.3(IL1RN):c.73+19C>T single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001511046] Chr2:113120147 [GRCh38]
Chr2:113877724 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.336C>T (p.Asp112=) single nucleotide variant Autoinflammatory syndrome [RCV002264327]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001452031] Chr2:113132673 [GRCh38]
Chr2:113890250 [GRCh37]
Chr2:2q14.1		 likely benign|uncertain significance
NM_173842.3(IL1RN):c.108A>G (p.Gln36=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001447017] Chr2:113127732 [GRCh38]
Chr2:113885309 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.206-65G>A single nucleotide variant not provided [RCV001534749]|not specified [RCV003399334] Chr2:113130980 [GRCh38]
Chr2:113888557 [GRCh37]
Chr2:2q14.1		 benign
NM_173841.3(IL1RN):c.10+148C>G single nucleotide variant not provided [RCV001671096] Chr2:113118176 [GRCh38]
Chr2:113875753 [GRCh37]
Chr2:2q14.1		 benign
NM_173841.3(IL1RN):c.10+168A>G single nucleotide variant not provided [RCV001619180] Chr2:113118196 [GRCh38]
Chr2:113875773 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.205+32G>A single nucleotide variant not provided [RCV001613596]|not specified [RCV003399414] Chr2:113129696 [GRCh38]
Chr2:113887273 [GRCh37]
Chr2:2q14.1		 benign
NC_000002.12:g.113117640A>C single nucleotide variant not provided [RCV001650019] Chr2:113117640 [GRCh38]
Chr2:113875217 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.205+135G>A single nucleotide variant not provided [RCV001690382] Chr2:113129799 [GRCh38]
Chr2:113887376 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.318+19T>G single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001510570] Chr2:113131176 [GRCh38]
Chr2:113888753 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.186A>G (p.Gly62=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001482386] Chr2:113129645 [GRCh38]
Chr2:113887222 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.384A>T (p.Ser128=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001406684] Chr2:113132721 [GRCh38]
Chr2:113890298 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173841.3(IL1RN):c.66C>T (p.Asp22=) single nucleotide variant Autoinflammatory syndrome [RCV002264317]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001432547] Chr2:113120121 [GRCh38]
Chr2:113877698 [GRCh37]
Chr2:2q14.1		 likely benign|uncertain significance
GRCh37/hg19 2q13-14.1(chr2:113609489-115817535)x3 copy number gain not provided [RCV001833062] Chr2:113609489..115817535 [GRCh37]
Chr2:2q13-14.1		 uncertain significance
GRCh37/hg19 2p25.3-q37.3(chr2:1-243199373) copy number gain Mosaic trisomy 2 [RCV002280628] Chr2:1..243199373 [GRCh37]
Chr2:2p25.3-q37.3		 pathogenic
NM_173842.3(IL1RN):c.173G>T (p.Gly58Val) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001873903] Chr2:113129632 [GRCh38]
Chr2:113887209 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.342C>T (p.Ser114=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001913922] Chr2:113132679 [GRCh38]
Chr2:113890256 [GRCh37]
Chr2:2q14.1		 likely benign|uncertain significance
NM_173842.3(IL1RN):c.380G>T (p.Arg127Leu) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001966854] Chr2:113132717 [GRCh38]
Chr2:113890294 [GRCh37]
Chr2:2q14.1		 uncertain significance
GRCh37/hg19 2q13-14.3(chr2:113188197-128144700) copy number loss not specified [RCV002053220] Chr2:113188197..128144700 [GRCh37]
Chr2:2q13-14.3		 pathogenic
NM_173842.3(IL1RN):c.476C>T (p.Thr159Ile) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001912813] Chr2:113132813 [GRCh38]
Chr2:113890390 [GRCh37]
Chr2:2q14.1		 uncertain significance
GRCh37/hg19 2q13(chr2:113295194-114085649)x3 copy number gain not provided [RCV001834499] Chr2:113295194..114085649 [GRCh37]
Chr2:2q13		 uncertain significance
GRCh37/hg19 2q13-22.3(chr2:111484468-146333604)x3 copy number gain not provided [RCV001832896] Chr2:111484468..146333604 [GRCh37]
Chr2:2q13-22.3		 pathogenic
NC_000002.12:g.(?_112924872)_(113105404_?)del deletion Endometriosis [RCV001824107] Chr2:112924872..113105404 [GRCh38]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.377T>C (p.Ile126Thr) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002034259] Chr2:113132714 [GRCh38]
Chr2:113890291 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.366C>T (p.Arg122=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001937416] Chr2:113132703 [GRCh38]
Chr2:113890280 [GRCh37]
Chr2:2q14.1		 likely benign
NC_000002.11:g.(?_113817016)_(113890448_?)del deletion Generalized pustular psoriasis [RCV003120785]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001963059] Chr2:113817016..113890448 [GRCh37]
Chr2:2q13		 pathogenic
NM_173842.3(IL1RN):c.259G>A (p.Gly87Arg) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001958565] Chr2:113131098 [GRCh38]
Chr2:113888675 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173841.3(IL1RN):c.16T>G (p.Leu6Val) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001926021] Chr2:113120071 [GRCh38]
Chr2:113877648 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.526G>T (p.Asp176Tyr) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002014700] Chr2:113132863 [GRCh38]
Chr2:113890440 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173841.3(IL1RN):c.20A>G (p.Tyr7Cys) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001919553] Chr2:113120075 [GRCh38]
Chr2:113877652 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.210G>T (p.Lys70Asn) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001877297] Chr2:113131049 [GRCh38]
Chr2:113888626 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.99C>G (p.Ser33Arg) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002018397] Chr2:113127723 [GRCh38]
Chr2:113885300 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.364C>T (p.Arg122Cys) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001940493] Chr2:113132701 [GRCh38]
Chr2:113890278 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.77G>A (p.Arg26Gln) single nucleotide variant Autoinflammatory syndrome [RCV002264444]|Inborn genetic diseases [RCV004045486]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001991725] Chr2:113127701 [GRCh38]
Chr2:113885278 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.343G>A (p.Glu115Lys) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002030838] Chr2:113132680 [GRCh38]
Chr2:113890257 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.427G>A (p.Gly143Ser) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002031046] Chr2:113132764 [GRCh38]
Chr2:113890341 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.241C>G (p.Leu81Val) single nucleotide variant Inborn genetic diseases [RCV003348666]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001953276] Chr2:113131080 [GRCh38]
Chr2:113888657 [GRCh37]
Chr2:2q14.1		 likely benign|uncertain significance
NM_173841.3(IL1RN):c.11-16A>C single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002109789] Chr2:113120050 [GRCh38]
Chr2:113877627 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.243G>A (p.Leu81=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002088659] Chr2:113131082 [GRCh38]
Chr2:113888659 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.261A>G (p.Gly87=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002145474]|not provided [RCV003438955] Chr2:113131100 [GRCh38]
Chr2:113888677 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173841.3(IL1RN):c.73+10T>C single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002155585] Chr2:113120138 [GRCh38]
Chr2:113877715 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173841.3(IL1RN):c.48A>G (p.Glu16=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002196730] Chr2:113120103 [GRCh38]
Chr2:113877680 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.206-11T>C single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002206641] Chr2:113131034 [GRCh38]
Chr2:113888611 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.417C>T (p.Ala139=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002128471] Chr2:113132754 [GRCh38]
Chr2:113890331 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.156C>T (p.Asn52=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002214819] Chr2:113129615 [GRCh38]
Chr2:113887192 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.447G>A (p.Ala149=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002105415] Chr2:113132784 [GRCh38]
Chr2:113890361 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.318+17G>A single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002105903] Chr2:113131174 [GRCh38]
Chr2:113888751 [GRCh37]
Chr2:2q14.1		 likely benign
GRCh37/hg19 2q13-22.3(chr2:112475655-145691999)x3 copy number gain 2q13q22.3 microduplication syndrome [RCV002226436] Chr2:112475655..145691999 [GRCh37]
Chr2:2q13-22.3		 pathogenic
NM_173842.3(IL1RN):c.319-16_319-12del deletion Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002150108] Chr2:113132640..113132644 [GRCh38]
Chr2:113890217..113890221 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.426C>G (p.Pro142=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002119381] Chr2:113132763 [GRCh38]
Chr2:113890340 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.116+15A>G single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002158481]|not provided [RCV004711880] Chr2:113127755 [GRCh38]
Chr2:113885332 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.319-17C>T single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002100985] Chr2:113132639 [GRCh38]
Chr2:113890216 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.300G>A (p.Glu100=) single nucleotide variant Microvascular complications of diabetes, susceptibility to, 4 [RCV002494137]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002219476] Chr2:113131139 [GRCh38]
Chr2:113888716 [GRCh37]
Chr2:2q14.1		 likely benign
NC_000002.11:g.(?_113875596)_(113890448_?)dup duplication Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003113846] Chr2:113875596..113890448 [GRCh37]
Chr2:2q13		 uncertain significance
NM_173842.3(IL1RN):c.390_391inv (p.Gly131Ser) inversion Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003095891]|not provided [RCV002261686] Chr2:113132727..113132728 [GRCh38]
Chr2:113890304..113890305 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173841.3(IL1RN):c.19T>C (p.Tyr7His) single nucleotide variant Autoinflammatory syndrome [RCV002264624] Chr2:113120074 [GRCh38]
Chr2:113877651 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173841.2(IL1RN):c.-95C>G single nucleotide variant Autoinflammatory syndrome [RCV002264630] Chr2:113117924 [GRCh38]
Chr2:113875501 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.207A>G (p.Glu69=) single nucleotide variant Autoinflammatory syndrome [RCV002264625]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003774816] Chr2:113131046 [GRCh38]
Chr2:113888623 [GRCh37]
Chr2:2q14.1		 likely benign|uncertain significance
NM_173841.3(IL1RN):c.10+2T>C single nucleotide variant Autoinflammatory syndrome [RCV002264623] Chr2:113118030 [GRCh38]
Chr2:113875607 [GRCh37]
Chr2:2q14.1		 likely pathogenic
NM_173842.3(IL1RN):c.288G>A (p.Lys96=) single nucleotide variant Autoinflammatory syndrome [RCV002264626] Chr2:113131127 [GRCh38]
Chr2:113888704 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.318+9A>T single nucleotide variant Autoinflammatory syndrome [RCV002264627] Chr2:113131166 [GRCh38]
Chr2:113888743 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.422G>C (p.Cys141Ser) single nucleotide variant Autoinflammatory syndrome [RCV002264628] Chr2:113132759 [GRCh38]
Chr2:113890336 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.423C>T (p.Cys141=) single nucleotide variant Autoinflammatory syndrome [RCV002264629] Chr2:113132760 [GRCh38]
Chr2:113890337 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.369C>T (p.Phe123=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002615673] Chr2:113132706 [GRCh38]
Chr2:113890283 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.117-18A>C single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002780004] Chr2:113129558 [GRCh38]
Chr2:113887135 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.145T>C (p.Tyr49His) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002614523] Chr2:113129604 [GRCh38]
Chr2:113887181 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.337C>T (p.Leu113=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003032509] Chr2:113132674 [GRCh38]
Chr2:113890251 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.396C>G (p.Pro132=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003021891] Chr2:113132733 [GRCh38]
Chr2:113890310 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.380G>A (p.Arg127His) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002953029] Chr2:113132717 [GRCh38]
Chr2:113890294 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.258T>C (p.His86=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003043524] Chr2:113131097 [GRCh38]
Chr2:113888674 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173841.3(IL1RN):c.10+4A>G single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003006514] Chr2:113118032 [GRCh38]
Chr2:113875609 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.319-12T>C single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002872215] Chr2:113132644 [GRCh38]
Chr2:113890221 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.116+13C>T single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002765755] Chr2:113127753 [GRCh38]
Chr2:113885330 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.97A>G (p.Ser33Gly) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002596723] Chr2:113127721 [GRCh38]
Chr2:113885298 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173841.3(IL1RN):c.18G>T (p.Leu6Phe) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002596732] Chr2:113120073 [GRCh38]
Chr2:113877650 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.444A>G (p.Thr148=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002632345] Chr2:113132781 [GRCh38]
Chr2:113890358 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173841.3(IL1RN):c.10+14A>C single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002937575] Chr2:113118042 [GRCh38]
Chr2:113875619 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.114C>T (p.Phe38=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003092072] Chr2:113127738 [GRCh38]
Chr2:113885315 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.206-16del deletion Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002646777] Chr2:113131026 [GRCh38]
Chr2:113888603 [GRCh37]
Chr2:2q14.1		 benign
NM_173842.3(IL1RN):c.306_312del (p.Arg102fs) deletion Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003048482] Chr2:113131141..113131147 [GRCh38]
Chr2:113888718..113888724 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.133C>T (p.Gln45Ter) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002653788] Chr2:113129592 [GRCh38]
Chr2:113887169 [GRCh37]
Chr2:2q14.1		 pathogenic
NM_173841.3(IL1RN):c.10+11T>C single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002676743] Chr2:113118039 [GRCh38]
Chr2:113875616 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173841.3(IL1RN):c.4G>T (p.Ala2Ser) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003068450] Chr2:113118022 [GRCh38]
Chr2:113875599 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.354G>T (p.Lys118Asn) single nucleotide variant Inborn genetic diseases [RCV003377404] Chr2:113132691 [GRCh38]
Chr2:113890268 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.71T>A (p.Ile24Asn) single nucleotide variant Inborn genetic diseases [RCV003369793] Chr2:113127695 [GRCh38]
Chr2:113885272 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.141del (p.Phe48fs) deletion IL1RN-related disorder [RCV003412253] Chr2:113129599 [GRCh38]
Chr2:113887176 [GRCh37]
Chr2:2q14.1		 likely pathogenic
NM_173841.3(IL1RN):c.11-17C>T single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003628654] Chr2:113120049 [GRCh38]
Chr2:113877626 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.274C>T (p.Leu92=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003515230] Chr2:113131113 [GRCh38]
Chr2:113888690 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.159C>T (p.Asn53=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003516541] Chr2:113129618 [GRCh38]
Chr2:113887195 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.519C>T (p.Phe173=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003513930] Chr2:113132856 [GRCh38]
Chr2:113890433 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.57C>G (p.Phe19Leu) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003629762] Chr2:113127681 [GRCh38]
Chr2:113885258 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.117-17G>C single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003516527] Chr2:113129559 [GRCh38]
Chr2:113887136 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.315G>A (p.Leu105=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003629791] Chr2:113131154 [GRCh38]
Chr2:113888731 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173841.3(IL1RN):c.52G>T (p.Glu18Ter) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003516199] Chr2:113120107 [GRCh38]
Chr2:113877684 [GRCh37]
Chr2:2q14.1		 pathogenic
NM_173842.3(IL1RN):c.111C>T (p.Ala37=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003629525] Chr2:113127735 [GRCh38]
Chr2:113885312 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173841.3(IL1RN):c.25G>T (p.Glu9Ter) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003630424] Chr2:113120080 [GRCh38]
Chr2:113877657 [GRCh37]
Chr2:2q14.1		 pathogenic
NM_173841.3(IL1RN):c.73+18T>C single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003516072] Chr2:113120146 [GRCh38]
Chr2:113877723 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.116+10C>A single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003876801] Chr2:113127750 [GRCh38]
Chr2:113885327 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.319-20G>T single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003629404] Chr2:113132636 [GRCh38]
Chr2:113890213 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.205+15G>A single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003628629] Chr2:113129679 [GRCh38]
Chr2:113887256 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173841.3(IL1RN):c.10+18dup duplication Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003865506] Chr2:113118045..113118046 [GRCh38]
Chr2:113875622..113875623 [GRCh37]
Chr2:2q14.1		 likely benign
GRCh37/hg19 2q12.2-21.2(chr2:106755586-134302739)x1 copy number loss not specified [RCV003986380] Chr2:106755586..134302739 [GRCh37]
Chr2:2q12.2-21.2		 pathogenic
GRCh37/hg19 2q13(chr2:113717386-113892480)x1 copy number loss not specified [RCV003986332] Chr2:113717386..113892480 [GRCh37]
Chr2:2q13		 uncertain significance
NM_173842.3(IL1RN):c.534G>A (p.Ter178=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV003857602] Chr2:113132871 [GRCh38]
Chr2:113890448 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.46del (p.Leu16fs) deletion Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV004006257] Chr2:113127669 [GRCh38]
Chr2:113885246 [GRCh37]
Chr2:2q14.1		 likely pathogenic
NM_173842.3(IL1RN):c.39T>A (p.Thr13=) single nucleotide variant IL1RN-related disorder [RCV003964221] Chr2:113127663 [GRCh38]
Chr2:113885240 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.260G>A (p.Gly87Glu) single nucleotide variant Inborn genetic diseases [RCV004405150] Chr2:113131099 [GRCh38]
Chr2:113888676 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.77G>C (p.Arg26Pro) single nucleotide variant Inborn genetic diseases [RCV004405151] Chr2:113127701 [GRCh38]
Chr2:113885278 [GRCh37]
Chr2:2q14.1		 uncertain significance
NC_000002.11:g.(?_113875596)_(113875625_?)del deletion Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV004582636] Chr2:113875596..113875625 [GRCh37]
Chr2:2q13		 pathogenic
NM_173842.3(IL1RN):c.395C>T (p.Pro132Leu) single nucleotide variant Inborn genetic diseases [RCV004987816] Chr2:113132732 [GRCh38]
Chr2:113890309 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173841.3(IL1RN):c.73+16G>T single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV005128408] Chr2:113120144 [GRCh38]
Chr2:113877721 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173841.3(IL1RN):c.11-14C>T single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV005135149] Chr2:113120052 [GRCh38]
Chr2:113877629 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173841.3(IL1RN):c.10+8C>T single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV005135709] Chr2:113118036 [GRCh38]
Chr2:113875613 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173841.3(IL1RN):c.10+12C>A single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV005195028] Chr2:113118040 [GRCh38]
Chr2:113875617 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173841.3(IL1RN):c.73+9T>C single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV005132640] Chr2:113120137 [GRCh38]
Chr2:113877714 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.206-11T>G single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV005115458] Chr2:113131034 [GRCh38]
Chr2:113888611 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.494G>C (p.Gly165Ala) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV005183860] Chr2:113132831 [GRCh38]
Chr2:113890408 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.294T>C (p.Gly98=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV005083765] Chr2:113131133 [GRCh38]
Chr2:113888710 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.318+9A>G single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV005204816] Chr2:113131166 [GRCh38]
Chr2:113888743 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.376A>T (p.Ile126Phe) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV005075004] Chr2:113132713 [GRCh38]
Chr2:113890290 [GRCh37]
Chr2:2q14.1		 uncertain significance
NM_173842.3(IL1RN):c.357G>A (p.Gln119=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV005178396] Chr2:113132694 [GRCh38]
Chr2:113890271 [GRCh37]
Chr2:2q14.1		 likely benign
NM_173842.3(IL1RN):c.402C>G (p.Thr134=) single nucleotide variant Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV005131655] Chr2:113132739 [GRCh38]
Chr2:113890316 [GRCh37]
Chr2:2q14.1		 likely benign
miRNA Target Status (No longer updated)

Predicted Target Of
Summary Value
Count of predictions:3377
Count of miRNA genes:822
Interacting mature miRNAs:938
Transcripts:ENST00000259206, ENST00000354115, ENST00000361779, ENST00000409052, ENST00000409930, ENST00000463073, ENST00000465812, ENST00000472292, ENST00000486167
Prediction methods:Microtar, Miranda, Rnahybrid, Targetscan
Result types:miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.


QTLs in Region (GRCh38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
597411995GWAS1508069_HC-reactive protein measurement QTL GWAS1508069 (human)3e-102C-reactive protein measurementblood C-reactive protein level (CMO:0003160)2113109711113109712Human
597465116GWAS1561190_Htotal cholesterol measurement QTL GWAS1561190 (human)2e-08total cholesterol measurementblood total cholesterol level (CMO:0000051)2113109711113109712Human
597473565GWAS1569639_Hmitochondrial heteroplasmy measurement QTL GWAS1569639 (human)1e-15mitochondrial heteroplasmy measurement2113118921113118922Human
597509785GWAS1605859_HC-reactive protein measurement QTL GWAS1605859 (human)3e-85C-reactive protein measurementblood C-reactive protein level (CMO:0003160)2113109711113109712Human
597606299GWAS1663159_Haspartate aminotransferase to alanine aminotransferase ratio QTL GWAS1663159 (human)4e-22aspartate aminotransferase to alanine aminotransferase ratioserum aspartate aminotransferase activity level to alanine aminotransferase activity level ratio (CMO:0002245)2113109711113109712Human
597016592GWAS1112666_Hdysmenorrheic pain measurement QTL GWAS1112666 (human)0.0000007dysmenorrheic pain measurement2113126129113126130Human
597465115GWAS1561189_Htotal cholesterol measurement QTL GWAS1561189 (human)0.0000008total cholesterol measurementblood total cholesterol level (CMO:0000051)2113109711113109712Human
407384512GWAS1033488_Hobsolete_red blood cell distribution width QTL GWAS1033488 (human)4e-16obsolete_red blood cell distribution width2113109711113109712Human
597212688GWAS1308762_Hinterleukin-1 beta measurement QTL GWAS1308762 (human)0.0000006interleukin-1 beta measurement2113131216113131217Human
597373972GWAS1470046_Hmean corpuscular hemoglobin concentration QTL GWAS1470046 (human)4e-12mean corpuscular hemoglobin concentrationmean corpuscular hemoglobin concentration (CMO:0000291)2113109711113109712Human
597597455GWAS1654315_Hlymphocyte count QTL GWAS1654315 (human)4e-40lymphocyte countblood lymphocyte count (CMO:0000031)2113109711113109712Human
597597323GWAS1654183_Hlymphocyte count QTL GWAS1654183 (human)1e-34lymphocyte countblood lymphocyte count (CMO:0000031)2113109711113109712Human
597488139GWAS1584213_Hmean corpuscular hemoglobin concentration QTL GWAS1584213 (human)7e-09mean corpuscular hemoglobin concentrationmean corpuscular hemoglobin concentration (CMO:0000291)2113116890113116891Human
407029082GWAS678058_HIGFBP-3 measurement QTL GWAS678058 (human)0.000002IGFBP-3 measurement2113132796113132797Human
597592455GWAS1649315_Hhigh density lipoprotein cholesterol measurement QTL GWAS1649315 (human)4e-11high density lipoprotein cholesterol measurementblood high density lipoprotein cholesterol level (CMO:0000052)2113109711113109712Human
597428226GWAS1524300_Hgout QTL GWAS1524300 (human)3e-19gout2113102461113102462Human
407081309GWAS730285_Hobsolete_red blood cell distribution width QTL GWAS730285 (human)2e-10triglyceride measurement2113109711113109712Human
597580544GWAS1637404_Hlymphocyte count QTL GWAS1637404 (human)2e-11lymphocyte countblood lymphocyte count (CMO:0000031)2113109711113109712Human
596962187GWAS1081706_Htriglyceride measurement QTL GWAS1081706 (human)2e-10Red cell distribution width2113109711113109712Human
597483580GWAS1579654_Hinterleukin-1 beta measurement QTL GWAS1579654 (human)0.0000004interleukin-1 beta measurement2113123370113123371Human
597483581GWAS1579655_Hinterleukin-1 beta measurement QTL GWAS1579655 (human)0.0000005interleukin-1 beta measurement2113119836113119837Human
597483583GWAS1579657_Hinterleukin-1 beta measurement QTL GWAS1579657 (human)0.0000006interleukin-1 beta measurement2113131002113131003Human
597483576GWAS1579650_Hinterleukin-1 beta measurement QTL GWAS1579650 (human)0.0000004interleukin-1 beta measurement2113112266113112267Human
597610555GWAS1667415_Hmonocyte count QTL GWAS1667415 (human)3e-19monocyte quantity (VT:0000223)blood monocyte count (CMO:0000032)2113109711113109712Human
597483577GWAS1579651_Hinterleukin-1 beta measurement QTL GWAS1579651 (human)0.0000004interleukin-1 beta measurement2113112226113112227Human
597483575GWAS1579649_Hinterleukin-1 beta measurement QTL GWAS1579649 (human)0.0000004interleukin-1 beta measurement2113108792113108793Human
597419184GWAS1515258_HC-reactive protein measurement QTL GWAS1515258 (human)0.0000002C-reactive protein measurementblood C-reactive protein level (CMO:0003160)2113116890113116891Human
597605170GWAS1662030_Hneutrophil count QTL GWAS1662030 (human)5e-19neutrophil quantity (VT:0000222)blood neutrophil count (CMO:0000030)2113109711113109712Human
597483568GWAS1579642_Hinterleukin-1 beta measurement QTL GWAS1579642 (human)6e-08interleukin-1 beta measurement2113122715113122716Human
597483569GWAS1579643_Hinterleukin-1 beta measurement QTL GWAS1579643 (human)0.0000002interleukin-1 beta measurement2113108948113108949Human
597603379GWAS1660239_Hneutrophil count QTL GWAS1660239 (human)5e-36neutrophil quantity (VT:0000222)blood neutrophil count (CMO:0000030)2113109711113109712Human
597483570GWAS1579644_Hinterleukin-1 beta measurement QTL GWAS1579644 (human)0.0000003interleukin-1 beta measurement2113117391113117392Human
597483571GWAS1579645_Hinterleukin-1 beta measurement QTL GWAS1579645 (human)0.0000004interleukin-1 beta measurement2113119649113119650Human
596950309GWAS1069828_HRed cell distribution width QTL GWAS1069828 (human)4e-16Red cell distribution width2113109711113109712Human
407385213GWAS1034189_Hobsolete_red blood cell distribution width QTL GWAS1034189 (human)8e-12obsolete_red blood cell distribution width2113109711113109712Human
597402158GWAS1498232_Hneutrophil percentage of leukocytes QTL GWAS1498232 (human)5e-33neutrophil quantity (VT:0000222)blood neutrophil count to total leukocyte count ratio (CMO:0000370)2113109711113109712Human
597605087GWAS1661947_Hneutrophil count QTL GWAS1661947 (human)2e-73neutrophil quantity (VT:0000222)blood C-reactive protein level (CMO:0003160)2113109711113109712Human
597581018GWAS1637878_Hmean corpuscular hemoglobin concentration QTL GWAS1637878 (human)9e-22mean corpuscular hemoglobin concentrationmean corpuscular hemoglobin concentration (CMO:0000291)2113109711113109712Human
597378525GWAS1474599_Hlymphocyte percentage of leukocytes QTL GWAS1474599 (human)5e-27lymphocyte quantity (VT:0000717)blood lymphocyte count to total leukocyte count ratio (CMO:0000371)2113109711113109712Human
597583321GWAS1640181_Hmean corpuscular hemoglobin concentration QTL GWAS1640181 (human)2e-17mean corpuscular hemoglobin concentrationmean corpuscular hemoglobin concentration (CMO:0000291)2113109711113109712Human
597526228GWAS1622302_Hinterleukin-1 receptor antagonist protein measurement QTL GWAS1622302 (human)1e-55interleukin-1 receptor antagonist protein measurement2113109711113109712Human
597458133GWAS1554207_HC-reactive protein measurement QTL GWAS1554207 (human)2e-73C-reactive protein measurement2113109711113109712Human
597363536GWAS1459610_Hlymphocyte percentage of leukocytes QTL GWAS1459610 (human)4e-09lymphocyte quantity (VT:0000717)blood lymphocyte count to total leukocyte count ratio (CMO:0000371)2113106901113106904Human
597599826GWAS1656686_Hmean corpuscular hemoglobin concentration QTL GWAS1656686 (human)6e-40mean corpuscular hemoglobin concentrationmean corpuscular hemoglobin concentration (CMO:0000291)2113109711113109712Human
597479762GWAS1575836_Hneutrophil count QTL GWAS1575836 (human)2e-56neutrophil quantity (VT:0000222)blood neutrophil count (CMO:0000030)2113109711113109712Human
597362378GWAS1458452_Hneutrophil percentage of leukocytes QTL GWAS1458452 (human)5e-11neutrophil quantity (VT:0000222)blood neutrophil count to total leukocyte count ratio (CMO:0000370)2113108257113108258Human
597502412GWAS1598486_Htriglyceride measurement QTL GWAS1598486 (human)1e-08triglyceride measurementblood triglyceride level (CMO:0000118)2113111413113111414Human
597382985GWAS1479059_HRed cell distribution width QTL GWAS1479059 (human)4e-16Red cell distribution widthred blood cell distribution width- standard deviation (CMO:0003232)2113109711113109712Human
597212875GWAS1308949_Hinterleukin-1 beta measurement QTL GWAS1308949 (human)0.000002interleukin-1 beta measurement2113131429113131430Human
597471688GWAS1567762_Hinterleukin-1 beta measurement QTL GWAS1567762 (human)0.0000007interleukin-1 beta measurement2113129761113129762Human
596950337GWAS1069856_HRed cell distribution width QTL GWAS1069856 (human)3e-17interleukin 1 receptor antagonist measurement2113109711113109712Human
597471689GWAS1567763_Hinterleukin-1 beta measurement QTL GWAS1567763 (human)0.0000007interleukin-1 beta measurement2113130095113130096Human
597471690GWAS1567764_Hinterleukin-1 beta measurement QTL GWAS1567764 (human)0.0000007interleukin-1 beta measurement2113129881113129882Human
597471691GWAS1567765_Hinterleukin-1 beta measurement QTL GWAS1567765 (human)0.0000007interleukin-1 beta measurement2113129822113129823Human
597383106GWAS1479180_HRed cell distribution width QTL GWAS1479180 (human)3e-17interleukin 1 receptor antagonist measurementred blood cell distribution width- standard deviation (CMO:0003232)2113109711113109712Human
597471685GWAS1567759_Hinterleukin-1 beta measurement QTL GWAS1567759 (human)0.0000007interleukin-1 beta measurement2113129685113129686Human
597471686GWAS1567760_Hinterleukin-1 beta measurement QTL GWAS1567760 (human)0.0000007interleukin-1 beta measurement2113129696113129697Human
597612613GWAS1669473_Hmean corpuscular hemoglobin concentration QTL GWAS1669473 (human)2e-49mean corpuscular hemoglobin concentrationmean corpuscular hemoglobin concentration (CMO:0000291)2113109711113109712Human
597471687GWAS1567761_Hinterleukin-1 beta measurement QTL GWAS1567761 (human)0.0000007interleukin-1 beta measurement2113129717113129718Human
596958280GWAS1077799_HRed cell distribution width QTL GWAS1077799 (human)8e-12Red cell distribution width2113109711113109712Human
597583811GWAS1640671_Hmean corpuscular hemoglobin concentration QTL GWAS1640671 (human)4e-24mean corpuscular hemoglobin concentrationmean corpuscular hemoglobin concentration (CMO:0000291)2113109711113109712Human
597361732GWAS1457806_Hneutrophil count, basophil count QTL GWAS1457806 (human)2e-20basophil quantity (VT:0002607)blood basophil count (CMO:0000034)2113106194113106195Human
597616638GWAS1673498_Hmean corpuscular hemoglobin concentration QTL GWAS1673498 (human)3e-33mean corpuscular hemoglobin concentrationmean corpuscular hemoglobin concentration (CMO:0000291)2113109711113109712Human
597383802GWAS1479876_Hmonocyte percentage of leukocytes QTL GWAS1479876 (human)2e-16monocyte quantity (VT:0000223)blood monocyte count to total leukocyte count ratio (CMO:0000374)2113109711113109712Human
597362681GWAS1458755_Hneutrophil count QTL GWAS1458755 (human)7e-21neutrophil quantity (VT:0000222)blood neutrophil count (CMO:0000030)2113108257113108258Human
597375481GWAS1471555_HRed cell distribution width QTL GWAS1471555 (human)8e-12Red cell distribution widthred blood cell distribution width- standard deviation (CMO:0003232)2113109711113109712Human
597360888GWAS1456962_Hgranulocyte count QTL GWAS1456962 (human)2e-21granulocyte quantity (VT:0000334)blood eosinophil count (CMO:0000033)2113106194113106195Human
597471353GWAS1567427_Hinterleukin-1 beta measurement QTL GWAS1567427 (human)0.000001interleukin-1 beta measurement2113130980113130981Human
597430779GWAS1526853_HRed cell distribution width QTL GWAS1526853 (human)2e-10triglyceride measurementblood triglyceride level (CMO:0000118)2113109711113109712Human
597211505GWAS1307579_Hinterleukin-1 beta measurement QTL GWAS1307579 (human)0.0000007interleukin-1 beta measurement2113128926113128927Human
597211506GWAS1307580_Hinterleukin-1 beta measurement QTL GWAS1307580 (human)0.0000007interleukin-1 beta measurement2113128807113128808Human
597322224GWAS1418298_Hinterleukin 1 receptor antagonist measurement QTL GWAS1418298 (human)9e-22interleukin 1 receptor antagonist measurement2113132707113132708Human
597527025GWAS1623099_Hmitochondrial DNA measurement QTL GWAS1623099 (human)4e-08mitochondrial DNA measurement2113109277113109278Human
597605362GWAS1662222_Hneutrophil count QTL GWAS1662222 (human)7e-79neutrophil quantity (VT:0000222)blood neutrophil count (CMO:0000030)2113109711113109712Human
597370230GWAS1466304_Hmean corpuscular hemoglobin QTL GWAS1466304 (human)3e-22mean corpuscular hemoglobinmean corpuscular hemoglobin (CMO:0000290)2113109711113109712Human
597211509GWAS1307583_Hinterleukin-1 beta measurement QTL GWAS1307583 (human)0.0000008interleukin-1 beta measurement2113128249113128250Human
597471346GWAS1567420_Hinterleukin-1 beta measurement QTL GWAS1567420 (human)0.000004interleukin-1 beta measurement2113103284113103285Human
597381365GWAS1477439_Hmean corpuscular hemoglobin concentration QTL GWAS1477439 (human)6e-11mean corpuscular hemoglobin concentrationmean corpuscular hemoglobin concentration (CMO:0000291)2113109711113109712Human
597471347GWAS1567421_Hinterleukin-1 beta measurement QTL GWAS1567421 (human)0.000004interleukin-1 beta measurement2113106194113106195Human
597211754GWAS1307828_Hinterleukin-1 beta measurement QTL GWAS1307828 (human)0.0000007interleukin-1 beta measurement2113130226113130227Human
597211755GWAS1307829_Hinterleukin-1 beta measurement QTL GWAS1307829 (human)0.0000007interleukin-1 beta measurement2113129630113129631Human

Markers in Region
RH17495  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh372113,890,540 - 113,890,674UniSTSGRCh37
Build 362113,607,011 - 113,607,145RGDNCBI36
Celera2107,275,138 - 107,275,272RGD
Cytogenetic Map2q14.2UniSTS
HuRef2106,344,844 - 106,344,978UniSTS
GeneMap99-GB4 RH Map2411.03UniSTS
NCBI RH Map2844.2UniSTS
GDB:182560  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh372113,887,202 - 113,888,680UniSTSGRCh37
Build 362113,603,673 - 113,605,151RGDNCBI36
Celera2107,271,886 - 107,273,278RGD
Cytogenetic Map2q14.2UniSTS
HuRef2106,341,678 - 106,342,984UniSTS
GDB:204180  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh372113,888,072 - 113,888,483UniSTSGRCh37
Build 362113,604,543 - 113,604,954RGDNCBI36
Celera2107,272,756 - 107,273,081RGD
Cytogenetic Map5q33.3UniSTS
Cytogenetic Map2q14.2UniSTS
HuRef2106,342,548 - 106,342,787UniSTS
HuRef5151,816,575 - 151,817,980UniSTS
IL1RN_3322  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh372113,890,235 - 113,891,019UniSTSGRCh37
Build 362113,606,706 - 113,607,490RGDNCBI36
Celera2107,274,833 - 107,275,617RGD
HuRef2106,344,539 - 106,345,323UniSTS
D2S2718  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh372113,890,569 - 113,890,917UniSTSGRCh37
Build 362113,607,040 - 113,607,388RGDNCBI36
Celera2107,275,167 - 107,275,515RGD
Cytogenetic Map2q14.2UniSTS
HuRef2106,344,873 - 106,345,221UniSTS
Stanford-G3 RH Map24796.0UniSTS
NCBI RH Map2847.2UniSTS
GeneMap99-G3 RH Map25709.0UniSTS
RH70911  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh372113,875,703 - 113,875,864UniSTSGRCh37
Build 362113,592,174 - 113,592,335RGDNCBI36
Celera2107,260,392 - 107,260,553RGD
Cytogenetic Map2q14.2UniSTS
HuRef2106,330,183 - 106,330,344UniSTS
GeneMap99-GB4 RH Map2412.71UniSTS
NCBI RH Map2844.2UniSTS
WI-13878  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh372113,891,434 - 113,891,561UniSTSGRCh37
Build 362113,607,905 - 113,608,032RGDNCBI36
Celera2107,276,032 - 107,276,159RGD
Cytogenetic Map2q14.2UniSTS
HuRef2106,345,738 - 106,345,865UniSTS
GeneMap99-GB4 RH Map2411.14UniSTS
Whitehead-RH Map2594.1UniSTS
NCBI RH Map2844.2UniSTS
RH11709  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh372113,891,299 - 113,891,501UniSTSGRCh37
Build 362113,607,770 - 113,607,972RGDNCBI36
Celera2107,275,897 - 107,276,099RGD
Cytogenetic Map2q14.2UniSTS
HuRef2106,345,603 - 106,345,805UniSTS
GeneMap99-GB4 RH Map2411.7UniSTS


Expression

RNA-SEQ Expression

adipose tissue
alimentary part of gastrointestinal system
appendage
circulatory system
ectoderm
endocrine system
endoderm
entire extraembryonic component
exocrine system
hemolymphoid system
hepatobiliary system
integumental system
mesenchyme
mesoderm
musculoskeletal system
nervous system
renal system
reproductive system
respiratory system
sensory system
visual system
1204 2417 2778 2230 4613 1713 2240 6 615 1780 458 2043 7071 6286 19 3592 828 1708 1513 174 1

Sequence

Nucleotide Sequences
RefSeq Transcripts NG_021240 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_000577 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001318914 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001379360 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_173841 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_173842 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_173843 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_011511121 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_047444184 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_047444185 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_047444186 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide A49726 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  A50144 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC024704 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF043143 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF057168 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF387734 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF387735 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ005835 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK290898 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK290926 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AM260202 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY196903 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC009745 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC068441 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BI766516 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BN000002 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471217 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CP068276 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DA667440 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  HI656437 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  LC715154 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  LC715155 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  LC715156 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M55646 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M63099 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M97748 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  OR818180 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U65590 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X52015 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X53296 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X64532 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X84348 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles

Ensembl Acc Id: ENST00000259206   ⟹   ENSP00000259206
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p14 Ensembl2113,117,897 - 113,134,016 (+)Ensembl
Ensembl Acc Id: ENST00000354115   ⟹   ENSP00000329072
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p14 Ensembl2113,117,897 - 113,134,016 (+)Ensembl
Ensembl Acc Id: ENST00000361779   ⟹   ENSP00000354816
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p14 Ensembl2113,117,893 - 113,134,016 (+)Ensembl
Ensembl Acc Id: ENST00000409052   ⟹   ENSP00000387210
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p14 Ensembl2113,099,360 - 113,134,013 (+)Ensembl
Ensembl Acc Id: ENST00000409930   ⟹   ENSP00000387173
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p14 Ensembl2113,127,598 - 113,134,014 (+)Ensembl
Ensembl Acc Id: ENST00000463073
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p14 Ensembl2113,099,487 - 113,115,690 (+)Ensembl
Ensembl Acc Id: ENST00000465812
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p14 Ensembl2113,099,315 - 113,120,080 (+)Ensembl
Ensembl Acc Id: ENST00000472292
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p14 Ensembl2113,127,576 - 113,129,982 (+)Ensembl
Ensembl Acc Id: ENST00000486167
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p14 Ensembl2113,117,981 - 113,130,121 (+)Ensembl
Ensembl Acc Id: ENST00000696879   ⟹   ENSP00000512947
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p14 Ensembl2113,127,483 - 113,133,536 (+)Ensembl
Ensembl Acc Id: ENST00000696880   ⟹   ENSP00000512948
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p14 Ensembl2113,127,695 - 113,134,014 (+)Ensembl
Ensembl Acc Id: ENST00000696881   ⟹   ENSP00000512949
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p14 Ensembl2113,117,941 - 113,133,001 (+)Ensembl
Ensembl Acc Id: ENST00000696882   ⟹   ENSP00000512950
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p14 Ensembl2113,127,613 - 113,133,428 (+)Ensembl
Ensembl Acc Id: ENST00000696883
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p14 Ensembl2113,130,895 - 113,132,937 (+)Ensembl
RefSeq Acc Id: NM_000577   ⟹   NP_000568
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh382113,117,971 - 113,134,014 (+)NCBI
GRCh372113,868,693 - 113,891,593 (+)NCBI
Build 362113,591,941 - 113,608,064 (+)NCBI Archive
HuRef2106,329,950 - 106,345,897 (+)ENTREZGENE
CHM1_12113,879,899 - 113,896,017 (+)NCBI
T2T-CHM13v2.02113,544,556 - 113,560,594 (+)NCBI
Sequence:
RefSeq Acc Id: NM_001318914   ⟹   NP_001305843
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh382113,117,971 - 113,134,014 (+)NCBI
CHM1_12113,879,899 - 113,896,017 (+)NCBI
T2T-CHM13v2.02113,544,556 - 113,560,594 (+)NCBI
Sequence:
RefSeq Acc Id: NM_001379360   ⟹   NP_001366289
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh382113,127,489 - 113,134,014 (+)NCBI
T2T-CHM13v2.02113,554,069 - 113,560,594 (+)NCBI
Sequence:
RefSeq Acc Id: NM_173841   ⟹   NP_776213
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh382113,117,971 - 113,134,014 (+)NCBI
GRCh372113,868,693 - 113,891,593 (+)NCBI
Build 362113,591,941 - 113,608,064 (+)NCBI Archive
HuRef2106,329,950 - 106,345,897 (+)ENTREZGENE
CHM1_12113,879,899 - 113,896,017 (+)NCBI
T2T-CHM13v2.02113,544,556 - 113,560,594 (+)NCBI
Sequence:
RefSeq Acc Id: NM_173842   ⟹   NP_776214
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh382113,127,598 - 113,134,014 (+)NCBI
GRCh372113,868,693 - 113,891,593 (+)NCBI
Build 362113,601,609 - 113,608,064 (+)NCBI Archive
HuRef2106,329,950 - 106,345,897 (+)ENTREZGENE
CHM1_12113,889,562 - 113,896,017 (+)NCBI
T2T-CHM13v2.02113,554,178 - 113,560,594 (+)NCBI
Sequence:
RefSeq Acc Id: NM_173843   ⟹   NP_776215
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh382113,117,971 - 113,134,014 (+)NCBI
GRCh372113,868,693 - 113,891,593 (+)NCBI
Build 362113,591,941 - 113,608,064 (+)NCBI Archive
HuRef2106,329,950 - 106,345,897 (+)ENTREZGENE
CHM1_12113,879,899 - 113,896,017 (+)NCBI
T2T-CHM13v2.02113,544,556 - 113,560,594 (+)NCBI
Sequence:
RefSeq Acc Id: XM_011511121   ⟹   XP_011509423
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh382113,099,360 - 113,134,014 (+)NCBI
Sequence:
RefSeq Acc Id: XM_047444184   ⟹   XP_047300140
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh382113,099,360 - 113,134,014 (+)NCBI
RefSeq Acc Id: XM_047444185   ⟹   XP_047300141
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh382113,099,360 - 113,134,014 (+)NCBI
RefSeq Acc Id: XM_047444186   ⟹   XP_047300142
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh382113,099,360 - 113,134,014 (+)NCBI
Protein Sequences
Protein RefSeqs NP_000568 (Get FASTA)   NCBI Sequence Viewer  
  NP_001305843 (Get FASTA)   NCBI Sequence Viewer  
  NP_001366289 (Get FASTA)   NCBI Sequence Viewer  
  NP_776213 (Get FASTA)   NCBI Sequence Viewer  
  NP_776214 (Get FASTA)   NCBI Sequence Viewer  
  NP_776215 (Get FASTA)   NCBI Sequence Viewer  
  XP_011509423 (Get FASTA)   NCBI Sequence Viewer  
  XP_047300140 (Get FASTA)   NCBI Sequence Viewer  
  XP_047300141 (Get FASTA)   NCBI Sequence Viewer  
  XP_047300142 (Get FASTA)   NCBI Sequence Viewer  
GenBank Protein AAA59138 (Get FASTA)   NCBI Sequence Viewer  
  AAB41943 (Get FASTA)   NCBI Sequence Viewer  
  AAB92268 (Get FASTA)   NCBI Sequence Viewer  
  AAB92269 (Get FASTA)   NCBI Sequence Viewer  
  AAB92270 (Get FASTA)   NCBI Sequence Viewer  
  AAC13499 (Get FASTA)   NCBI Sequence Viewer  
  AAC39672 (Get FASTA)   NCBI Sequence Viewer  
  AAH09745 (Get FASTA)   NCBI Sequence Viewer  
  AAN87150 (Get FASTA)   NCBI Sequence Viewer  
  AAX93278 (Get FASTA)   NCBI Sequence Viewer  
  BAF83587 (Get FASTA)   NCBI Sequence Viewer  
  BAF83615 (Get FASTA)   NCBI Sequence Viewer  
  BDM75010 (Get FASTA)   NCBI Sequence Viewer  
  BDM75011 (Get FASTA)   NCBI Sequence Viewer  
  BDM75012 (Get FASTA)   NCBI Sequence Viewer  
  CAA03191 (Get FASTA)   NCBI Sequence Viewer  
  CAA03210 (Get FASTA)   NCBI Sequence Viewer  
  CAA06730 (Get FASTA)   NCBI Sequence Viewer  
  CAA36262 (Get FASTA)   NCBI Sequence Viewer  
  CAA37386 (Get FASTA)   NCBI Sequence Viewer  
  CAA45832 (Get FASTA)   NCBI Sequence Viewer  
  CAA59087 (Get FASTA)   NCBI Sequence Viewer  
  CAD29879 (Get FASTA)   NCBI Sequence Viewer  
  CAJ91094 (Get FASTA)   NCBI Sequence Viewer  
  CBY45189 (Get FASTA)   NCBI Sequence Viewer  
  EAW73621 (Get FASTA)   NCBI Sequence Viewer  
  EAW73622 (Get FASTA)   NCBI Sequence Viewer  
  EAW73623 (Get FASTA)   NCBI Sequence Viewer  
  EAW73624 (Get FASTA)   NCBI Sequence Viewer  
  EAW73625 (Get FASTA)   NCBI Sequence Viewer  
Ensembl Protein ENSP00000259206
  ENSP00000259206.5
  ENSP00000329072
  ENSP00000329072.3
  ENSP00000354816
  ENSP00000354816.3
  ENSP00000387173
  ENSP00000387173.3
  ENSP00000387210
  ENSP00000387210.1
  ENSP00000512947
  ENSP00000512947.1
  ENSP00000512948.1
  ENSP00000512949
  ENSP00000512949.1
GenBank Protein P18510 (Get FASTA)   NCBI Sequence Viewer  
RefSeq Acc Id: NP_776213   ⟸   NM_173841
- Peptide Label: isoform 2
- UniProtKB: P18510 (UniProtKB/Swiss-Prot)
- Sequence:
RefSeq Acc Id: NP_776215   ⟸   NM_173843
- Peptide Label: isoform 4
- Sequence:
RefSeq Acc Id: NP_000568   ⟸   NM_000577
- Peptide Label: isoform 3
- UniProtKB: P18510 (UniProtKB/Swiss-Prot)
- Sequence:
RefSeq Acc Id: NP_776214   ⟸   NM_173842
- Peptide Label: isoform 1 precursor
- UniProtKB: Q96GD6 (UniProtKB/Swiss-Prot),   Q7RTZ4 (UniProtKB/Swiss-Prot),   Q53SC2 (UniProtKB/Swiss-Prot),   Q14628 (UniProtKB/Swiss-Prot),   A8K4G1 (UniProtKB/Swiss-Prot),   Q9UPC0 (UniProtKB/Swiss-Prot),   P18510 (UniProtKB/Swiss-Prot)
- Sequence:
RefSeq Acc Id: XP_011509423   ⟸   XM_011511121
- Peptide Label: isoform X1
- Sequence:
RefSeq Acc Id: NP_001305843   ⟸   NM_001318914
- Peptide Label: isoform 4
- Sequence:
RefSeq Acc Id: NP_001366289   ⟸   NM_001379360
- Peptide Label: isoform 4
Ensembl Acc Id: ENSP00000354816   ⟸   ENST00000361779
Ensembl Acc Id: ENSP00000259206   ⟸   ENST00000259206
Ensembl Acc Id: ENSP00000329072   ⟸   ENST00000354115
Ensembl Acc Id: ENSP00000387173   ⟸   ENST00000409930
Ensembl Acc Id: ENSP00000387210   ⟸   ENST00000409052
Ensembl Acc Id: ENSP00000512950   ⟸   ENST00000696882
Ensembl Acc Id: ENSP00000512949   ⟸   ENST00000696881
Ensembl Acc Id: ENSP00000512947   ⟸   ENST00000696879
Ensembl Acc Id: ENSP00000512948   ⟸   ENST00000696880
RefSeq Acc Id: XP_047300140   ⟸   XM_047444184
- Peptide Label: isoform X1
RefSeq Acc Id: XP_047300141   ⟸   XM_047444185
- Peptide Label: isoform X1
RefSeq Acc Id: XP_047300142   ⟸   XM_047444186
- Peptide Label: isoform X1

Protein Structures
Name Modeler Protein Id AA Range Protein Structure
AF-P18510-F1-model_v2 AlphaFold P18510 1-177 view protein structure

Promoters
RGD ID:6861390
Promoter ID:EPDNEW_H3860
Type:initiation region
Name:IL1RN_3
Description:interleukin 1 receptor antagonist
SO ACC ID:SO:0000170
Source:EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)
Alternative Promoters:null; see alsoEPDNEW_H3859  EPDNEW_H3861  EPDNEW_H3862  
Experiment Methods:Single-end sequencing.
Position:
Human AssemblyChrPosition (strand)Source
GRCh382113,117,866 - 113,117,926EPDNEW
RGD ID:6861392
Promoter ID:EPDNEW_H3861
Type:initiation region
Name:IL1RN_2
Description:interleukin 1 receptor antagonist
SO ACC ID:SO:0000170
Source:EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)
Alternative Promoters:null; see alsoEPDNEW_H3859  EPDNEW_H3860  EPDNEW_H3862  
Experiment Methods:Single-end sequencing.
Position:
Human AssemblyChrPosition (strand)Source
GRCh382113,117,971 - 113,118,031EPDNEW
RGD ID:6861394
Promoter ID:EPDNEW_H3862
Type:initiation region
Name:IL1RN_1
Description:interleukin 1 receptor antagonist
SO ACC ID:SO:0000170
Source:EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)
Alternative Promoters:null; see alsoEPDNEW_H3859  EPDNEW_H3860  EPDNEW_H3861  
Experiment Methods:Single-end sequencing.
Position:
Human AssemblyChrPosition (strand)Source
GRCh382113,127,598 - 113,127,658EPDNEW

Additional Information

Database Acc Id Source(s)
AGR Gene HGNC:6000 AgrOrtholog
COSMIC IL1RN COSMIC
Ensembl Genes ENSG00000136689 Ensembl, ENTREZGENE, UniProtKB/Swiss-Prot
Ensembl Transcript ENST00000259206 ENTREZGENE
  ENST00000259206.9 UniProtKB/Swiss-Prot
  ENST00000354115 ENTREZGENE
  ENST00000354115.6 UniProtKB/Swiss-Prot
  ENST00000361779 ENTREZGENE
  ENST00000361779.7 UniProtKB/Swiss-Prot
  ENST00000409052 ENTREZGENE
  ENST00000409052.6 UniProtKB/Swiss-Prot
  ENST00000409930 ENTREZGENE
  ENST00000409930.4 UniProtKB/Swiss-Prot
  ENST00000696879 ENTREZGENE
  ENST00000696879.1 UniProtKB/Swiss-Prot
  ENST00000696880.1 UniProtKB/Swiss-Prot
  ENST00000696881 ENTREZGENE
  ENST00000696881.1 UniProtKB/Swiss-Prot
Gene3D-CATH 2.80.10.50 UniProtKB/Swiss-Prot
GTEx ENSG00000136689 GTEx
HGNC ID HGNC:6000 ENTREZGENE
Human Proteome Map IL1RN Human Proteome Map
InterPro IL-1_CS UniProtKB/Swiss-Prot
  IL-1_fam UniProtKB/Swiss-Prot
  IL-1RA/IL-36 UniProtKB/Swiss-Prot
  IL1/FGF UniProtKB/Swiss-Prot
KEGG Report hsa:3557 UniProtKB/Swiss-Prot
NCBI Gene 3557 ENTREZGENE
OMIM 147679 OMIM
PANTHER PTHR10078 UniProtKB/Swiss-Prot
  PTHR10078:SF28 UniProtKB/Swiss-Prot
Pfam IL1 UniProtKB/Swiss-Prot
PharmGKB PA29816 PharmGKB
PRINTS INTERLEUKIN1 UniProtKB/Swiss-Prot
  INTRLEUKIN1X UniProtKB/Swiss-Prot
PROSITE INTERLEUKIN_1 UniProtKB/Swiss-Prot
SMART IL1 UniProtKB/Swiss-Prot
Superfamily-SCOP SSF50353 UniProtKB/Swiss-Prot
UniProt A0A8Q3WMN6_HUMAN UniProtKB/TrEMBL
  A8K4G1 ENTREZGENE
  IL1RA_HUMAN UniProtKB/Swiss-Prot, ENTREZGENE
  Q14628 ENTREZGENE
  Q53SC2 ENTREZGENE
  Q7RTZ4 ENTREZGENE
  Q96GD6 ENTREZGENE
  Q9UPC0 ENTREZGENE
UniProt Secondary A8K4G1 UniProtKB/Swiss-Prot
  Q14628 UniProtKB/Swiss-Prot
  Q53SC2 UniProtKB/Swiss-Prot
  Q7RTZ4 UniProtKB/Swiss-Prot
  Q96GD6 UniProtKB/Swiss-Prot
  Q9UPC0 UniProtKB/Swiss-Prot