Adamts16<sup>em1Bj</sup> (ADAM metallopeptidase with thrombospondin type 1 motif, 16; ZFN mutant1,Bj) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Adamts16em1Bj (ADAM metallopeptidase with thrombospondin type 1 motif, 16; ZFN mutant1,Bj) Rattus norvegicus
Analyze
Symbol: Adamts16em1Bj
Name: ADAM metallopeptidase with thrombospondin type 1 motif, 16; ZFN mutant1,Bj
RGD ID: 13437613
Description: This allele was induced by injecting ZFNs target sequence CCGCGGTTGCTTTGCGCTCTGGGTGCTGTTGCTGGCGCA into Dahl S rat eggs as . The resulting mutation is a 17-bp deletion of the sequence gctctgggtgctgttgc in exon 1.
ASSOCIATED WITH decreased systemic arterial diastolic blood pressure; decreased systemic arterial systolic blood pressure; extended life span; ASSOCIATED WITH cryptorchidism; hypertension; male infertility
Type: allele  of Adamts16  
Previously known as: Adamts16em1Bj; Adamts16em1Bj
Is Marker For: Strains:   SS-Adamts16em1Bj  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position: No map positions available.


Disease Annotations     Click to see Annotation Detail View

References

References - curated
# Reference Title Reference Citation
1. Cryptorchidism and infertility in rats with targeted disruption of the Adamts16 locus. Abdul-Majeed S, etal., PLoS One. 2014 Jul 1;9(7):e100967. doi: 10.1371/journal.pone.0100967. eCollection 2014.
2. Targeted disruption of Adamts16 gene in a rat genetic model of hypertension. Gopalakrishnan K, etal., Proc Natl Acad Sci U S A. 2012 Dec 11;109(50):20555-9. doi: 10.1073/pnas.1211290109. Epub 2012 Nov 26.
3. Interplay between collagenase and undescended testes in Adamts16 knockout rats. Sarila G, etal., J Pediatr Surg. 2020 Jan 7. pii: S0022-3468(19)30929-7. doi: 10.1016/j.jpedsurg.2019.12.019.

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Adamts16em1Bj-var1 chr1 32430681 32430697 GCTCTGGGTGCTGTTGC - deletion mRatBN7.2
Adamts16em1Bj-var1 chr1 35067513 35067529 GCTCTGGGTGCTGTTGC - deletion Rnor_6.0

Related Rat Strains
The following Strains have been annotated to Adamts16em1Bj


Expression


Sequence

Nucleotide Sequences


Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2017-10-24 Adamts16em1Bj  ADAM metallopeptidase with thrombospondin type 1 motif, 16; ZFN mutant1,Bj  Adamts16em1Bj  ADAM metallopeptidase with thrombospondin type 1 motif, 16; ZFN mutant1,Bj  Symbol changed 629549 APPROVED