Esr1<sup>em1Soar</sup> (estrogen receptor 1; ZFN induced mutant 1, Soar) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways
Gene: Esr1em1Soar (estrogen receptor 1; ZFN induced mutant 1, Soar) Rattus norvegicus
Analyze
Symbol: Esr1em1Soar
Name: estrogen receptor 1; ZFN induced mutant 1, Soar
RGD ID: 12910736
Description: zinc finger nucleases were used to generate a 482 bp deletion in Esr1 gene, resulting in a knock out.
ASSOCIATED WITH abnormal body size; abnormal female reproductive system morphology; abnormal male reproductive system morphology; ASSOCIATED WITH infertility
Type: allele  of Esr1  
Previously known as: Esr1em1Soar
Is Marker For: Strains:   SD-Esr1em1Soar   ACI.SD-Esr1em1Soar  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position: No map positions available.


References

References - curated
# Reference Title Reference Citation
1. Generation of esr1-knockout rats using zinc finger nuclease-mediated genome editing. Rumi MA, etal., Endocrinology. 2014 May;155(5):1991-9. doi: 10.1210/en.2013-2150. Epub 2014 Feb 7.

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Esr1em1Soar-var1 chr1 41272347 41272828 GCTCAACTTTGTTTTGTTTTATGGATAATCCGCTGGAGTATGCGGTCCATTTCTTAAACAAGTTTGTAGAGAAAATCAATTTTTCTTCAAGGTTAATACAACAGGCAAACACCTTTTGCTGCATGTGTCAGAAAGAGACAATGAAAGATCATTGTGTAGATTATGAACCATTATTTCAAAATGTCAGAATAAAGTGGGTCTGCTGCATCCCCCCTGGTCTCACACTCTTCAGAGGGGAAAGAGGGCTTGCTTCTCAAATGCTAATGGATTTGCTTTCCCCCCTTCCTATCCCACCCCCAGGTCCAATTCTGACAATCGACGCCAGAATGGCCGAGAGAGACTCTCCAGCAGCAGCGAGAAGGGAAACATGATCATGGAGTCTGCCAAGGAGACTCGCTACTGTGCTGTGTGTAACGACTATGCCTCTGGCTACCATTATGGGGTCTGGTCCTGTGAAGGCTGCAAGGCTTTCTTTAAGAGAA - deletion mRatBN7.2
Esr1em1Soar-var1 chr1 41358808 41359289 GCTCAACTTTGTTTTGTTTTATGGATAATCCGCTGGAGTATGCGGTCCATTTCTTAAACAAGTTTGTAGAGAAAATCAATTTTTCTTCAAGGTTAATACAACAGGCAAACACCTTTTGCTGCATGTGTCAGAAAGAGACAATGAAAGATCATTGTGTAGATTATGAACCATTATTTCAAAATGTCAGAATAAAGTGGGTCTGCTGCATCCCCCCTGGTCTCACACTCTTCAGAGGGGAAAGAGGGCTTGCTTCTCAAATGCTAATGGATTTGCTTTCCCCCCTTCCTATCCCACCCCCAGGTCCAATTCTGACAATCGACGCCAGAATGGCCGAGAGAGACTCTCCAGCAGCAGCGAGAAGGGAAACATGATCATGGAGTCTGCCAAGGAGACTCGCTACTGTGCTGTGTGTAACGACTATGCCTCTGGCTACCATTATGGGGTCTGGTCCTGTGAAGGCTGCAAGGCTTTCTTTAAGAGAA - deletion Rnor_6.0

Related Rat Strains
The following Strains have been annotated to Esr1em1Soar


Expression


Sequence

Nucleotide Sequences


Additional Information