Mmp12<sup>em2Soar</sup> (matrix metallopeptidase 12; TALEN induced mutant 2,Soar) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Mmp12em2Soar (matrix metallopeptidase 12; TALEN induced mutant 2,Soar) Rattus norvegicus
Analyze
Symbol: Mmp12em2Soar
Name: matrix metallopeptidase 12; TALEN induced mutant 2,Soar
RGD ID: 12910506
Description: The TALEN genome editing system caused a 607-bp deletion in the exon 2 of rat Mmp12
ASSOCIATED WITH decreased fetal weight; decreased litter size
Type: allele  of Mmp12  
Previously known as: Mmp12^[em2Soar]; Mmp12em2Soar
Is Marker For: Strains:   SD-Mmp12em2Soar  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position: No map positions available.


Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype
References

References - curated
# Reference Title Reference Citation
1. HIF-KDM3A-MMP12 regulatory circuit ensures trophoblast plasticity and placental adaptations to hypoxia. Chakraborty D, etal., Proc Natl Acad Sci U S A. 2016 Nov 15;113(46):E7212-E7221. Epub 2016 Nov 2.

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Mmp12em2Soar-var1 chr8 4582897 4583503 TGCAATGCTTGTGTTTTGTCTAGTGGTACTTGTCAAGATTTTTTGACTATCAAGGGGACAGAATTCCAATGACAAAAACAAAAACCAATAGAAACCTCCTAGAAGAAAAACTCCAGGAAATGCAGCAGTTCTTTGGGCTAGAAGTAACTGGGCAACTGGACACCTCAACTCTGAAAATAATGCACACGTCTCGATGTGGAGTGCCTGATGTACAGCATCTTAGAGCAGTGCCCCAGAGGTCAAGATGGATGAAGCGGTATCTCACTTACAGGTAATGTCATTGGAGAACTCTTCTACTTGCCTATGAGTGTAGCCTCTAGAACCCTAGAACATTTAGCTACAACGAAATTCTAAATCCAAGAGTAGCCTCTGCAAATTGTTAATACAAATGTGTTCATTTTCTCCAGACTGGGTTGATGGCTCAGTGGAAAAAGCACTTGTCATACACTATAAGGGCCAGAGTTCAGACCACAAGAAGCCAGGCATGGCGGCTGCCTATAATCCCAGCACATGGGAGGAAGAGATGGGGATGCCTAGGGCAAGTTGGCTAGCCAGATTAGTAGAATTAGGGGTCTTTGGCTTTGGTTGAGAGAACTTTCCTCAATAA - deletion mRatBN7.2
Mmp12em2Soar-var1 chr8 5607704 5608310 TGCAATGCTTGTGTTTTGTCTAGTGGTACTTGTCAAGATTTTTTGACTATCAAGGGGACAGAATTCCAATGACAAAAACAAAAACCAATAGAAACCTCCTAGAAGAAAAACTCCAGGAAATGCAGCAGTTCTTTGGGCTAGAAGTAACTGGGCAACTGGACACCTCAACTCTGAAAATAATGCACACGTCTCGATGTGGAGTGCCTGATGTACAGCATCTTAGAGCAGTGCCCCAGAGGTCAAGATGGATGAAGCGGTATCTCACTTACAGGTAATGTCATTGGAGAACTCTTCTACTTGCCTATGAGTGTAGCCTCTAGAACCCTAGAACATTTAGCTACAACGAAATTCTAAATCCAAGAGTAGCCTCTGCAAATTGTTAATACAAATGTGTTCATTTTCTCCAGACTGGGTTGATGGCTCAGTGGAAAAAGCACTTGTCATACACTATAAGGGCCAGAGTTCAGACCACAAGAAGCCAGGCATGGCGGCTGCCTATAATCCCAGCACATGGGAGGAAGAGATGGGGATGCCTAGGGCAAGTTGGCTAGCCAGATTAGTAGAATTAGGGGTCTTTGGCTTTGGTTGAGAGAACTTTCCTCAATAA - deletion Rnor_6.0

Related Rat Strains
The following Strains have been annotated to Mmp12em2Soar


Expression


Sequence

Nucleotide Sequences


Additional Information