Kcnq1<sup>dfk</sup> (potassium voltage-gated channel subfamily Q member 1;deafness Kyoto) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Kcnq1dfk (potassium voltage-gated channel subfamily Q member 1;deafness Kyoto) Rattus norvegicus
Analyze
Symbol: Kcnq1dfk
Name: potassium voltage-gated channel subfamily Q member 1;deafness Kyoto
RGD ID: 12802344
Description: A naturally occurring deletion mutation arising on the genetic background of an inbred WTC strain. It is a 2040-bp deletion that included whole exon 7 and its flanking sequences of the Kcnq1 gene.
ASSOCIATED WITH abnormal cardiovascular system physiology; decreased body weight; impaired balance; ASSOCIATED WITH Achlorhydria; Deafness; hypertension
Type: allele  of Kcnq1  
Also known as: Kcnq1dfk
Is Marker For: Strains:   WTC-Kcnq1dfkKyo  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position: No map positions available.


Disease Annotations     Click to see Annotation Detail View

References

References - curated
1. Gohma H, etal., Physiol Genomics. 2006 Feb 14;24(3):198-206. Epub 2005 Dec 20.

Genomics


Related Rat Strains
The following Strains have been annotated to Kcnq1dfk


Expression


Sequence

Nucleotide Sequences

Rat Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type
Kcnq1dfk-var1 chr1 216377021 216379067 AAGATGTCTGGACAGCATGTGCCCTGGCTGTCAGTCCTGGGTATAACCTCTAGACCCCAATGTGTACTCGTATCCTCATGGTCCCTCAGCTCAGCCAGTGATACATGTTCCCTCGTGTGCATATGAGTGTGAACAGGTATCCTTGTCTCCATGTGAGGCACGTTTACAACTGTTATGCCCACATATGTAGAACAGGGTGGTCCCTTTAAAGGGTGCAACCATGAATGGTTTGTTATGCCCTCTGTTTGTGTAGGGCATGGATTTGTTTAAGGACAATGACATTGTGGGGAAGATTTCATATGGGCAGTTGTGGGAAAACACCAGGATGCAGCCAATATAGCATGGTGCAGCACCGAAGGGGTGGCCCTGTGGTGGCCTGGACCCAGCTGTGGACTGCTCTGTTGTTTGCCATCCAGGAAAAATTGACCTGTTGCTTCATGACCTGTTAACATACTGGCCAGAGTGACAAACTTGGCGCTGTGGGGTTACTCTTGCTGTCCCTGTCCCCTGCTCCCCTGCTGCAGTTGGTCAGAGTGCTTACCTATGTTGTAAGCATCCATGTCTACACCCACTCATATGTACCTATTAACTTCTGACTCCCATGCCTCCCTTGCCTTCCCCTGCTCTTTGGTGGTCACTGGGGAACAGTTGTGGTCCACAGCAGTTCATCTGGGAATGGAGTGGGTAGTGATGACAGTGGGCTGGGGGTGGGGTGAGGATCTTGAGGCTTTCTCTCTGAGCCCCACATTAGTTGGTATCTATTAGGTGGTGTTTCCCAAGCCCCATCCTTGTTGACCCTATTGGGCAGAGGTTCACTTAGAGGTTCTTATGTAGATCCTGGCTGGGTGGTTGTTACCTGGCCCCCAAGGGGTAACACTCTAGGTGTCTAGAGTAATCAGGCTATAAAGACCTTGAATGGGCAGGTTCTCCTATCACACTAACCTGCCTTGACTGAAGGGCTGATCTGGACAGTGTTGTGACCCCGAGGGCTGTGTGTTAGTGAATGTAACTATTCTGTTCGCCTGGCAGGCCCAAGGCAGCCTCATGGTGTGACCTAGCGGTTAGGCACAGCCAGGGTGGGCCCCTGAGTCGCTCCCCAGGAGTAAACCTCAGATGTCAGCAGGGGGTTGCGGGGGGTAGCCCCCCTCACTCCTATTGNGTCCCACTGCATACCCTGGACGCTGCTCTCCCACCAAGAAGGCTAGAGCCTTGTCTTATTCTCTCTGAAAAGGAAAAATAAAACATCTGGATCCCTGGGGTGGTGGCAGGAAGCAGCATGTCAGGCCATCCTGGGCTTTGTGGACTGCTGGCCTCAGTGGGAGCTTCTGGCCTCCAGGGGGCCAGTGCACTGCAACTCTGGTGGCCGGGGAAGGGATCCTTAGGATGGGGCAGGAAGCCTGGCCCCTGTGGGTGGGCTCTGAGTTCTTTGCCTGTCTTGCACCCCCCCAAGCTGTCTGCAACCCTAGGGCTGTGCCATCTGTGGTAATCAGAGTTGAGGGACTTAGGAGACTCAGAAACTTGAACGAACTCATCATATTGCTGTCCCTGGTACTTTCTCAGAACCATGCCTCATTACCCTGGTGGGCAGGGTTTTAAGTTGGTCTTCTTGTCATCAAGCCACTGTGTTAGGGCTGGCAGATGTCCCTTCTGAGGCTCTGAGCCTGCCAGCCACTGACTGCAGTCCTTTTTCTTTACAGGTCACAGTCACCACCATTGGCTACGGGGATAAGGTACCCCAGACATGGGTTGGGAAGACCATCGCCTCCTGTTTCTCTGTCTTCGCCATATCCTTCTTTGCACTCCCAGCGGTGGGTACCCATTAAGACCCCTCTCCCTTGTTCCCCACTCACCTTTGCCCCAACTCCTAGGCATTCCTTGAAGTAGAGTAAGGAGGCCTTGGCACTTCACAGAAGCAGCAAGGTACAGGGGAGCAGACTGGGCAGAACCTGCAGCTCCACAGCCTGGAGTGGCTCTGTCCTTTGACTTTTCCAAAAATCACTAACCTATGTCTACACATGTGTGTTACATGGGACACACGCCGGTTACT - deletion

Additional Information