![]()
Phenotype Annotations Click to see Annotation Detail View
Mammalian PhenotypeTerm | Qualifier | Evidence | With | Reference | Notes | Source | Original Reference(s) | absent coat pigmentation | | IMP | | 12792973 | | RGD | | |
|
![]()
Phenotype Annotations Click to see Annotation Detail View
Mammalian PhenotypeTerm | Qualifier | Evidence | With | Reference | Notes | Source | Original Reference(s) | absent coat pigmentation | | IMP | | 12792973 | | RGD | | |
# | Reference Title | Reference Citation |
1. | Efficient gene targeting by TAL effector nucleases coinjected with exonucleases in zygotes. | Mashimo T, etal., Sci Rep. 2013;3:1253. doi: 10.1038/srep01253. Epub 2013 Feb 13. |
Name | Chromosome | Start Pos | End Pos | Reference Nucleotide | Variant Nucleotide | Variant Type | Assembly |
Tyrem1Kyo-var1 | chr1 | 141201016 | 141201044 | AGTGGTCCCTCAGGTGTTCCATCACATAA | - | deletion | mRatBN7.2 |
Tyrem1Kyo-var1 | chr1 | 151097612 | 151097640 | AGTGGTCCCTCAGGTGTTCCATCACATAA | - | deletion | Rnor_6.0 |