Adgrl3<sup>em1Huyc</sup> (adhesion G protein-coupled receptor L3; CRISPR/Cas9 induced mutant1, Huyc) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Adgrl3em1Huyc (adhesion G protein-coupled receptor L3; CRISPR/Cas9 induced mutant1, Huyc) Rattus norvegicus
Analyze
Symbol: Adgrl3em1Huyc
Name: adhesion G protein-coupled receptor L3; CRISPR/Cas9 induced mutant1, Huyc
RGD ID: 127285662
Description: The CRISPR/Cas9 system was used to to delete exon 3 of the rat Adgrl3 (Lphn3). Two sgRNAs targeting the sequences flanking exon 3 (GTCCCTTGCCAGTACATCTC and CCTAGTGTTGTGTTCTGCTA),Cas9 mRNA with the CRISPR/Cas9 reagents was injected into fertilized eggs. Genotyping of founder rats was confirmed by PCR genotyping using three primers: 1. AAAGGGTCATAGCATCCGGC, 2. CTAACGTGGCTTTTTGTCTTCT, and 3. GCTCGACAGACAGTGTGGAT. The WT band occurs at ~320 bp and KO band at ~452 bp.
ASSOCIATED WITH enhanced behavioral response to amphetamine; hyperactivity; increased startle reflex
Type: allele  of Adgrl3  
Previously known as: Adgrl3^[em1Huyc]
Is Marker For: Strains:   SD-Adgrl3em1Huyc  
Latest Assembly: GRCr8 - GRCr8 Assembly
Position: No map positions available.


Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype
References

References - curated
# Reference Title Reference Citation
1. Knockout of latrophilin-3 in Sprague-Dawley rats causes hyperactivity, hyper-reactivity, under-response to amphetamine, and disrupted dopamine markers. Regan SL, etal., Neurobiol Dis. 2019 Oct;130:104494. doi: 10.1016/j.nbd.2019.104494. Epub 2019 Jun 6.

Genomics


Related Rat Strains
The following Strains have been annotated to Adgrl3em1Huyc


Expression

RNA-SEQ Expression


Sequence

Nucleotide Sequences


Additional Information