Advanced Search (OLGA)

Gene: MIR200B (microRNA mir-200b) Canis lupus familiaris

Analyze

Symbol:

MIR200B

Name:

microRNA mir-200b (Ensembl:microRNA 200b)

RGD ID:

12178805

Description:

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

cfa-mir-200b; microRNA 200b

RGD Orthologs

Human

Mouse

Rat

Alliance Orthologs

More Info

more info ...

Latest Assembly:

CanFam3.1 - Dog CanFam3.1 Assembly

Position:

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	5	56,368,400 - 56,368,479 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	5	56,368,400 - 56,368,479 (+)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	5	56,445,394 - 56,445,473 (+)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	5	56,571,297 - 56,571,376 (+)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	5	56,571,297 - 56,571,376 (+)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	5	56,562,064 - 56,562,143 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	5	56,454,322 - 56,454,401 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	5	56,844,315 - 56,844,394 (+)	NCBI		UU_Cfam_GSD_1.0

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Breast Neoplasms (ISO)

chromosome 1p36 deletion syndrome (ISO)

colon cancer (ISO)

congenital myasthenic syndrome 8 (ISO)

dilated cardiomyopathy 1LL (ISO)

Disease Progression (ISO)

Ehlers-Danlos syndrome spondylodysplastic type 2 (ISO)

Experimental Liver Neoplasms (ISO)

Goldberg-Shprintzen syndrome (ISO)

hepatocellular carcinoma (ISO)

immunodeficiency 16 (ISO)

immunodeficiency 38 (ISO)

intrahepatic cholangiocarcinoma (ISO)

Joubert syndrome 25 (ISO)

liver cirrhosis (ISO)

Liver Metastasis (ISO)

malignant pleural mesothelioma (ISO)

metabolic dysfunction-associated steatotic liver disease (ISO)

Neoplasm Invasiveness (ISO)

Neoplastic Cell Transformation (ISO)

Neurodevelopmental Disorders (ISO)

pancreatitis (ISO)

Peroxisome Biogenesis Disorder, Complementation Group 7 (ISO)

pre-malignant neoplasm (ISO)

primary sclerosing cholangitis (ISO)

Shprintzen-Goldberg Craniosynostosis (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to amino acid stimulus (ISO)

cellular response to leukemia inhibitory factor (ISO)

interneuron axon guidance (ISO)

miRNA-mediated gene silencing by inhibition of translation (ISO)

miRNA-mediated gene silencing by mRNA destabilization (ISO)

miRNA-mediated post-transcriptional gene silencing (IEA,ISO)

negative regulation of angiogenesis (ISO)

negative regulation of apoptotic process (ISO)

negative regulation of blood vessel endothelial cell migration (ISO)

negative regulation of gene expression (ISO)

negative regulation of interleukin-33 production (ISO)

negative regulation of toll-like receptor 4 signaling pathway (ISO)

negative regulation of vascular wound healing (ISO)

olfactory bulb interneuron differentiation (ISO)

positive regulation of cell population proliferation (ISO)

response to bacterium (ISO)

sensory perception of sound (ISO)

Wnt signaling pathway (ISO)

Cellular Component

RISC complex (IEA)

Molecular Function

mRNA 3'-UTR binding (ISO)

mRNA base-pairing post-transcriptional repressor activity (ISO)

References

Additional References at PubMed

PMID:16381832	PMID:18215311

Genomics

Comparative Map Data

MIR200B
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	5	56,368,400 - 56,368,479 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	5	56,368,400 - 56,368,479 (+)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	5	56,445,394 - 56,445,473 (+)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	5	56,571,297 - 56,571,376 (+)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	5	56,571,297 - 56,571,376 (+)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	5	56,562,064 - 56,562,143 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	5	56,454,322 - 56,454,401 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	5	56,844,315 - 56,844,394 (+)	NCBI		UU_Cfam_GSD_1.0

MIR200B
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	1	1,167,104 - 1,167,198 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	1	1,167,104 - 1,167,198 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	1	1,102,484 - 1,102,578 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	1	1,092,346 - 1,092,440 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	1	1,480,246 - 1,480,340 (-)	NCBI		Celera
Cytogenetic Map	1	p36.33	NCBI
HuRef	1	373,865 - 373,959 (+)	NCBI		HuRef
CHM1_1	1	1,089,454 - 1,089,548 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	1	595,701 - 595,795 (+)	NCBI		T2T-CHM13v2.0

Mir200b
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	4	156,140,138 - 156,140,207 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	4	156,140,138 - 156,140,207 (-)	Ensembl		GRCm39 Ensembl
GRCm38	4	156,055,681 - 156,055,750 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	4	156,055,681 - 156,055,750 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	4	155,429,790 - 155,429,859 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	4	158,318,077 - 158,318,146 (-)	NCBI		Celera
Cytogenetic Map	4	E2	NCBI
cM Map	4	87.96	NCBI

Mir200b
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	5	171,931,495 - 171,931,589 (-)	NCBI		GRCr8
mRatBN7.2	5	166,649,272 - 166,649,366 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	5	166,649,272 - 166,649,366 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	5	169,352,812 - 169,352,906 (-)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	5	171,174,234 - 171,174,328 (-)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	5	171,136,768 - 171,136,862 (-)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	5	173,490,144 - 173,490,238 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	5	173,490,144 - 173,490,238 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	5	176,964,166 - 176,964,260 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	5	164,850,075 - 164,850,169 (-)	NCBI		Celera
Cytogenetic Map	5	q36	NCBI

Expression

RNA-SEQ Expression

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_049454	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AAEX04000005	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAAHUQ010000065	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAAQRD010000089	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAAUVH010000371	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	REHQ01000005	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSCAFT00000035055

Type:

CODING

Position:

Dog Assembly	Chr	Position (strand)	Source
CanFam3.1 Ensembl	5	56,368,400 - 56,368,479 (+)	Ensembl

Ensembl Acc Id:

ENSCAFT00845040309

Type:

CODING

Position:

Dog Assembly	Chr	Position (strand)	Source
ROS_Cfam_1.0 Ensembl	5	56,571,297 - 56,571,376 (+)	Ensembl

RefSeq Acc Id:

NR_049454

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Dog Assembly	Chr	Position (strand)	Source
CanFam3.1	5	56,368,400 - 56,368,479 (+)	NCBI
Dog10K_Boxer_Tasha	5	56,445,394 - 56,445,473 (+)	NCBI
ROS_Cfam_1.0	5	56,571,297 - 56,571,376 (+)	NCBI
UMICH_Zoey_3.1	5	56,562,064 - 56,562,143 (+)	NCBI
UNSW_CanFamBas_1.0	5	56,454,322 - 56,454,401 (+)	NCBI
UU_Cfam_GSD_1.0	5	56,844,315 - 56,844,394 (+)	NCBI

Sequence:

show sequence

GCCATCGCCATCTTACTGGGCAGCATTGGATGGTGTCAGGTCTCTAATACTGCCTGGTAATGAT
GACGGCGGGGCCCTGC

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSCAFG00000022951	Ensembl
	ENSCAFG00845022840	Ensembl, ENTREZGENE
Ensembl Transcript	ENSCAFT00845040309	ENTREZGENE
miRBase	MI0010361	ENTREZGENE
NCBI Gene	MIR200B	ENTREZGENE
RNAcentral	URS000012A1DD	RNACentral
	URS00007E388C	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2019-04-02	MIR200B	microRNA mir-200b		microRNA 200b	Symbol and/or name change	5135510	APPROVED

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD

Send us a Message

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD