Fmr1<sup>em1Sage</sup> (FMRP translational regulator 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Fmr1em1Sage (FMRP translational regulator 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs) Rattus norvegicus
Analyze
Symbol: Fmr1em1Sage
Name: FMRP translational regulator 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs
RGD ID: 11568041
Description: The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Fmr1 into Sprague Dawley embryos. The resulting mutation was a 122bp deletion of the intron 7/exon8 junction occurred at 18533bp-18654bp and caused knockout of Fmr1 demonstrated by western blot.
ASSOCIATED WITH abnormal operant conditioning behavior; abnormal social play behavior; abnormal visual evoked potential; ASSOCIATED WITH autism spectrum disorder; fragile X syndrome
Type: allele  of Fmr1  
Previously known as: Fmr1em1Sage; fragile X mental retardation 1;zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs
Is Marker For: Strains:   SD-Fmr1em1Sage  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position: No map positions available.


Disease Annotations     Click to see Annotation Detail View

Phenotype Annotations     Click to see Annotation Detail View
References

References - curated
# Reference Title Reference Citation
1. Sensory hypo-excitability in a rat model of fetal development in Fragile X Syndrome. Berzhanskaya J, etal., Sci Rep. 2016 Jul 28;6:30769. doi: 10.1038/srep30769.
2. Deletion of the KH1 Domain of Fmr1 Leads to Transcriptional Alterations and Attentional Deficits in Rats. Golden CEM, etal., Cereb Cortex. 2019 May 1;29(5):2228-2244. doi: 10.1093/cercor/bhz029.
3. Fmr1 and Nlgn3 knockout rats: novel tools for investigating autism spectrum disorders. Hamilton SM, etal., Behav Neurosci. 2014 Apr;128(2):103-9. doi: 10.1037/a0035988.

Genomics


Related Rat Strains
The following Strains have been annotated to Fmr1em1Sage


Expression


Sequence

Nucleotide Sequences

Rat Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type
Fmr1em1Sage-var1 chrX 147258833 147258954 CATGGCTGGCCTAAATGAAATTGACTTAATAATTGGTAAAACAAGTTAATCACTTGTGCATTTCTCTTCAGAGTTCAAGGCAGCTTGCCTCAAGATTTCATGAACAGTTTATCGTACGAGAA - deletion
Fmr1em1Sage-var1 chrX 154703661 154703782 CATGGCTGGCCTAAATGAAATTGACTTAATAATTGGTAAAACAAGTTAATCACTTGTGCATTTCTCTTCAGAGTTCAAGGCAGCTTGCCTCAAGATTTCATGAACAGTTTATCGTACGAGAA - deletion

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2021-03-26 Fmr1em1Sage  FMRP translational regulator 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs  Fmr1em1Sage  fragile X mental retardation 1;zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs  Name changed 629549 APPROVED