Ednrb<sup>sl</sup> (endothelin receptor type B, spotting lethal) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Ednrbsl (endothelin receptor type B, spotting lethal) Rattus norvegicus
Analyze
Symbol: Ednrbsl
Name: endothelin receptor type B, spotting lethal
RGD ID: 10755424
Description: This allele has a 301-bp deletion spanning the exon 1-intron 1 junction of the Ednrb gene is a spontaneous null mutation identified in spotting lethal rats.
ASSOCIATED WITH abnormal coat/hair pigmentation; abnormal spleen B cell follicle morphology; abnormal spleen development; ASSOCIATED WITH Hirschsprung's disease; Hypopigmentation; lymphopenia
Type: allele  of Ednrb  
Previously known as: EdnrbslHkv; Ednrbsl
Is Marker For: Strains:   SI-Tg(Ednrb)Ywa   Sl   LE.AR-Ednrbsl/Okkm   AR-Ednrbsl/Okkm   AR-Ednrbsl/Hkv   LE/Hkv.AR-Ednrbsl   F344.AR-Ednrbsl/Hkv  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position:
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Cytogenetic Map15 RGD


References

References - curated
# Reference Title Reference Citation
1. Lymphopenia in Ednrb-deficient rat was strongly modified by genetic background. Dang R, etal., Biomed Res. 2012;33(4):249-53.
2. QTL analysis identifies a modifier locus of aganglionosis in the rat model of Hirschsprung disease carrying Ednrb(sl) mutations. Dang R, etal., PLoS One. 2011;6(11):e27902. Epub 2011 Nov 22.
3. Genetic background strongly modifies the severity of symptoms of Hirschsprung disease, but not hearing loss in rats carrying Ednrb(sl) mutations. Dang R, etal., PLoS One. 2011;6(9):e24086. Epub 2011 Sep 7.
4. Null mutation of endothelin receptor type B gene in spotting lethal rats causes aganglionic megacolon and white coat color. Gariepy CE, etal., Proc Natl Acad Sci U S A 1996 Jan 23;93(2):867-72.
5. QTL analysis of modifiers for pigmentary disorder in rats carrying Ednrb(sl) mutations. Huang J, etal., Sci Rep. 2016 Jan 22;6:19697. doi: 10.1038/srep19697.

Genomics


Related Rat Strains
The following Strains have been annotated to Ednrbsl


Expression


Sequence

Nucleotide Sequences

Rat Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type
Ednrbsl-var1 chr15 80670748 80671048 CCCACCCCTGGTTTCCAGACCTGCAGATCACTATCAGGTACGTTACCTTGTAGGCATTAATGGGAATGTCGATGATGATGTGTAGCAGATCTCCCAGAGCCAGGCTGGCGATCAAGATATTGGGACCATTTCTCATGCACTTGTTCTTGTAGATGATTCTTAGCAGTGTGGAGTTCCCGATGATGCCTAGCACGAACACGAGGCATGATACAATCGTGTTGATGTATTTAAAAGTCTTGTTGATCTCAATTTTTCGTTGGCACGGAGGAGGGAAGGATCTTGGCGGGACTCCAGCCACCCT - deletion
Ednrbsl-var1 chr15 88034987 88035287 CCCACCCCTGGTTTCCAGACCTGCAGATCACTATCAGGTACGTTACCTTGTAGGCATTAATGGGAATGTCGATGATGATGTGTAGCAGATCTCCCAGAGCCAGGCTGGCGATCAAGATATTGGGACCATTTCTCATGCACTTGTTCTTGTAGATGATTCTTAGCAGTGTGGAGTTCCCGATGATGCCTAGCACGAACACGAGGCATGATACAATCGTGTTGATGTATTTAAAAGTCTTGTTGATCTCAATTTTTCGTTGGCACGGAGGAGGGAAGGATCTTGGCGGGACTCCAGCCACCCT - deletion

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2016-11-07 Ednrbsl  endothelin receptor type B, spotting lethal  EdnrbSl  endothelin receptor type B, spotting lethal  Symbol changed 629549 APPROVED
2016-10-31 EdnrbSl  endothelin receptor type B, spotting lethal  EdnrbSlHkv  endothelin receptor type B, spotting lethal  Symbol changed 629549 APPROVED