Ednrb<sup>sl</sup> (endothelin receptor type B, spotting lethal) - Rat Genome Database

Send us a Message



 Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap)  (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Gene: Ednrbsl (endothelin receptor type B, spotting lethal) Rattus norvegicus
Analyze
Symbol: Ednrbsl
Name: endothelin receptor type B, spotting lethal
RGD ID: 10755424
Description: This allele has a 301-bp deletion spanning the exon 1-intron 1 junction of the Ednrb gene is a spontaneous null mutation identified in spotting lethal rats.
ASSOCIATED WITH abnormal coat/hair pigmentation; abnormal spleen B cell follicle morphology; abnormal spleen development; ASSOCIATED WITH Hirschsprung's disease; Hypopigmentation; lymphopenia
Type: allele  of Ednrb  
Previously known as: EdnrbslHkv; Ednrbsl
Is Marker For: Strains:   SI-Tg(Ednrb)Ywa   Sl   LE.AR-Ednrbsl/Okkm   AR-Ednrbsl/Okkm   AR-Ednrbsl/Hkv   LE/Hkv.AR-Ednrbsl   F344.AR-Ednrbsl/Hkv  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position:
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Cytogenetic Map15 RGD


References

References - curated
# Reference Title Reference Citation
1. Lymphopenia in Ednrb-deficient rat was strongly modified by genetic background. Dang R, etal., Biomed Res. 2012;33(4):249-53.
2. QTL analysis identifies a modifier locus of aganglionosis in the rat model of Hirschsprung disease carrying Ednrb(sl) mutations. Dang R, etal., PLoS One. 2011;6(11):e27902. Epub 2011 Nov 22.
3. Genetic background strongly modifies the severity of symptoms of Hirschsprung disease, but not hearing loss in rats carrying Ednrb(sl) mutations. Dang R, etal., PLoS One. 2011;6(9):e24086. Epub 2011 Sep 7.
4. Null mutation of endothelin receptor type B gene in spotting lethal rats causes aganglionic megacolon and white coat color. Gariepy CE, etal., Proc Natl Acad Sci U S A 1996 Jan 23;93(2):867-72.
5. QTL analysis of modifiers for pigmentary disorder in rats carrying Ednrb(sl) mutations. Huang J, etal., Sci Rep. 2016 Jan 22;6:19697. doi: 10.1038/srep19697.

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Ednrbsl-var1 chr15 80670748 80671048 CCCACCCCTGGTTTCCAGACCTGCAGATCACTATCAGGTACGTTACCTTGTAGGCATTAATGGGAATGTCGATGATGATGTGTAGCAGATCTCCCAGAGCCAGGCTGGCGATCAAGATATTGGGACCATTTCTCATGCACTTGTTCTTGTAGATGATTCTTAGCAGTGTGGAGTTCCCGATGATGCCTAGCACGAACACGAGGCATGATACAATCGTGTTGATGTATTTAAAAGTCTTGTTGATCTCAATTTTTCGTTGGCACGGAGGAGGGAAGGATCTTGGCGGGACTCCAGCCACCCT - deletion mRatBN7.2
Ednrbsl-var1 chr15 88034987 88035287 CCCACCCCTGGTTTCCAGACCTGCAGATCACTATCAGGTACGTTACCTTGTAGGCATTAATGGGAATGTCGATGATGATGTGTAGCAGATCTCCCAGAGCCAGGCTGGCGATCAAGATATTGGGACCATTTCTCATGCACTTGTTCTTGTAGATGATTCTTAGCAGTGTGGAGTTCCCGATGATGCCTAGCACGAACACGAGGCATGATACAATCGTGTTGATGTATTTAAAAGTCTTGTTGATCTCAATTTTTCGTTGGCACGGAGGAGGGAAGGATCTTGGCGGGACTCCAGCCACCCT - deletion Rnor_6.0

Related Rat Strains
The following Strains have been annotated to Ednrbsl


Expression


Sequence

Nucleotide Sequences


Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2016-11-07 Ednrbsl  endothelin receptor type B, spotting lethal  EdnrbSl  endothelin receptor type B, spotting lethal  Symbol changed 629549 APPROVED
2016-10-31 EdnrbSl  endothelin receptor type B, spotting lethal  EdnrbSlHkv  endothelin receptor type B, spotting lethal  Symbol changed 629549 APPROVED