|
|
|
|
|
|
# | Reference Title | Reference Citation |
1. | HomeCageScan analysis reveals ongoing pain in Fabry rats. | Burand AJ, etal., Neurobiol Pain. 2023 Jan 5;13:100113. doi: 10.1016/j.ynpai.2022.100113. eCollection 2023 Jan-Jul. |
2. | Platelet and myeloid cell phenotypes in a rat model of Fabry disease. | Kanack AJ, etal., FASEB J. 2021 Aug;35(8):e21818. doi: 10.1096/fj.202001727RR. |
3. | α-Galactosidase A-deficient rats accumulate glycosphingolipids and develop cardiorenal phenotypes of Fabry disease. | Miller JJ, etal., FASEB J. 2019 Jan;33(1):418-429. doi: 10.1096/fj.201800771R. Epub 2018 Jul 6. |
4. | Neuropathic pain in a Fabry disease rat model. | Miller JJ, etal., JCI Insight. 2018 Mar 22;3(6). pii: 99171. doi: 10.1172/jci.insight.99171. |
5. | Rats deficient in α-galactosidase A develop ocular manifestations of Fabry disease. | Miller JJ, etal., Sci Rep. 2019 Jun 28;9(1):9392. doi: 10.1038/s41598-019-45837-1. |
6. | Data registered by Dr. Melinda Dwinell’s group | Personal communication between Dr. Melinda Dwinell’s group and the RGD curators |
7. | Sensory-specific peripheral nerve pathology in a rat model of Fabry disease. | Waltz TB, etal., Neurobiol Pain. 2021 Sep 2;10:100074. doi: 10.1016/j.ynpai.2021.100074. eCollection 2021 Aug-Dec. |
Name | Chromosome | Start Pos | End Pos | Reference Nucleotide | Variant Nucleotide | Variant Type | Assembly |
Glaem2Mcwi-var1 | chrX | 105301986 | 105302032 | CCTCTCGGGAGCCATCCAGCAGTCATCTATGCAGAGGTATTCATAAC | - | deletion | Rnor_5.0 |