Gla<sup>em2Mcwi</sup> (galactosidase, alpha; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin) - Rat Genome Database

Send us a Message



 Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes QTLs Strains Markers Community Projects Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap)  (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Gene: Glaem2Mcwi (galactosidase, alpha; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin) Rattus norvegicus
Analyze
Symbol: Glaem2Mcwi
Name: galactosidase, alpha; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin
RGD ID: 10054395
Description: This allele was made by CRISPR/Cas9 system. The resulting mutation is a 47-bp deletion in the Gla gene
ASSOCIATED WITH abnormal glycosphingolipid level; abnormal sensory neuron morphology; allodynia; ASSOCIATED WITH Fabry disease; lysosomal storage disease; Pain
Type: allele  of Gla  
Previously known as: Glaem2Mcwi
Is Marker For: Strains:   DA-Glaem2Mcwi  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position:
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Cytogenetic MapX RGD


Disease Annotations     Click to see Annotation Detail View

Phenotype Annotations     Click to see Annotation Detail View
References

References - curated
# Reference Title Reference Citation
1. Neuropathic pain in a Fabry disease rat model. Miller JJ, etal., JCI Insight. 2018 Mar 22;3(6). pii: 99171. doi: 10.1172/jci.insight.99171.
2. Data registered by Dr. Melinda Dwinell’s group Personal communication between Dr. Melinda Dwinell’s group and the RGD curators

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Glaem2Mcwi-var1 chrX 105301986 105302032 CCTCTCGGGAGCCATCCAGCAGTCATCTATGCAGAGGTATTCATAAC - deletion Rnor_5.0

Related Rat Strains
The following Strains have been annotated to Glaem2Mcwi
DA-Glaem2Mcwi    


Expression


Sequence

Nucleotide Sequences


Additional Information